EMAIL THIS PAGE TO A FRIEND

METTL15

methyltransferase like 15

Synonyms: METT5D1
UniProtKB ID: A6NJ78, A8MRS5, B7WNU2, Q3MHD3, Q8N601, Q8NBA7
Gene ID:
Mouse(76894) methyltransferase like 15
chicken(421606) methyltransferase like 15
cow(533987) methyltransferase like 15
domestic cat(101083204) methyltransferase like 15
dog(476897) methyltransferase like 15
naked mole-rat(101705663) methyltransferase like 15
domestic guinea pig(100729434) methyltransferase like 15
sheep(101117961) methyltransferase like 15
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113528 Rosetta Predictions human pricing
NM_152636 Rosetta Predictions human pricing
NM_029790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326011 predicted 1542
2 SASI_Hs02_00326012 predicted 1678
3 SASI_Hs02_00326013 predicted 1646
4 SASI_Hs02_00326014 predicted 867
5 SASI_Hs02_00326015 predicted 622
6 SASI_Hs02_00326016 predicted 832
7 SASI_Hs02_00326017 predicted 1594
8 SASI_Hs02_00326018 predicted 784
9 SASI_Hs02_00326019 predicted 1606
10 SASI_Hs02_00326020 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366512 predicted 650
2 SASI_Hs02_00366513 predicted 813
3 SASI_Hs02_00366514 predicted 685
4 SASI_Hs01_00189351 predicted 868
5 SASI_Hs01_00189352 predicted 628
6 SASI_Hs01_00189353 predicted 834
7 SASI_Hs01_00189357 predicted 775
8 SASI_Hs02_00366515 predicted 613
9 SASI_Hs02_00366516 predicted 651
10 SASI_Hs02_00366517 predicted 970
11 SASI_Hs01_00189348 predicted 886
12 SASI_Hs01_00189349 predicted 910
13 SASI_Hs01_00189350 predicted 509
14 SASI_Hs01_00189354 predicted 1030
15 SASI_Hs01_00189355 predicted 507
16 SASI_Hs01_00189356 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045533 predicted 356
2 SASI_Mm01_00045534 predicted 593
3 SASI_Mm01_00045535 predicted 318
4 SASI_Mm01_00045536 predicted 444
5 SASI_Mm01_00045537 predicted 327
6 SASI_Mm01_00045538 predicted 843
7 SASI_Mm01_00045539 predicted 1145
8 SASI_Mm01_00045540 predicted 382
9 SASI_Mm01_00045541 predicted 830
10 SASI_Mm02_00335936 predicted 1069
11 SASI_Mm01_00045532 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152636
METTL15 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-894s21c1
Sequence:CCGGAGCCAGGCAGAAGCCTTATTACTCGAGTAATAAGGCTTCTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-590s21c1
Sequence:CCGGCCGGGAGCAAACAGATCAAACCTCGAGGTTTGATCTGTTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152636.2-1725s21c1
Sequence:CCGGAGCTTAGAGCAGCTATCAAATCTCGAGATTTGATAGCTGCTCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152636.1-1867s1c1
Sequence:CCGGGCTTTCTCAAATGTAGGCTTTCTCGAGAAAGCCTACATTTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-729s1c1
Sequence:CCGGGCTGATGTTGTGAATGCTTTACTCGAGTAAAGCATTCACAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-890s1c1
Sequence:CCGGCTCTGAAACATATTTCCCAGTCTCGAGACTGGGAAATATGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-760s1c1
Sequence:CCGGCACTTGCATCTATCCTAAGAACTCGAGTTCTTAGGATAGATGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-744s1c1
Sequence:CCGGGCTTTAGATCAACAGGCACTTCTCGAGAAGTGCCTGTTGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152636
METTL15 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-894s21c1
Sequence:CCGGAGCCAGGCAGAAGCCTTATTACTCGAGTAATAAGGCTTCTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-590s21c1
Sequence:CCGGCCGGGAGCAAACAGATCAAACCTCGAGGTTTGATCTGTTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152636.2-1725s21c1
Sequence:CCGGAGCTTAGAGCAGCTATCAAATCTCGAGATTTGATAGCTGCTCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152636.1-1867s1c1
Sequence:CCGGGCTTTCTCAAATGTAGGCTTTCTCGAGAAAGCCTACATTTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-729s1c1
Sequence:CCGGGCTGATGTTGTGAATGCTTTACTCGAGTAAAGCATTCACAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-890s1c1
Sequence:CCGGCTCTGAAACATATTTCCCAGTCTCGAGACTGGGAAATATGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-760s1c1
Sequence:CCGGCACTTGCATCTATCCTAAGAACTCGAGTTCTTAGGATAGATGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-744s1c1
Sequence:CCGGGCTTTAGATCAACAGGCACTTCTCGAGAAGTGCCTGTTGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152636
METTL15 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-894s21c1
Sequence:CCGGAGCCAGGCAGAAGCCTTATTACTCGAGTAATAAGGCTTCTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152636.2-590s21c1
Sequence:CCGGCCGGGAGCAAACAGATCAAACCTCGAGGTTTGATCTGTTTGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152636.2-1725s21c1
Sequence:CCGGAGCTTAGAGCAGCTATCAAATCTCGAGATTTGATAGCTGCTCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148099    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152636.1-1867s1c1
Sequence:CCGGGCTTTCTCAAATGTAGGCTTTCTCGAGAAAGCCTACATTTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-729s1c1
Sequence:CCGGGCTGATGTTGTGAATGCTTTACTCGAGTAAAGCATTCACAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-890s1c1
Sequence:CCGGCTCTGAAACATATTTCCCAGTCTCGAGACTGGGAAATATGTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-760s1c1
Sequence:CCGGCACTTGCATCTATCCTAAGAACTCGAGTTCTTAGGATAGATGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152636.1-744s1c1
Sequence:CCGGGCTTTAGATCAACAGGCACTTCTCGAGAAGTGCCTGTTGATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029790
METTL15 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029790.1-1663s1c1
Sequence:CCGGCCATATTTCATACAGTGGAAACTCGAGTTTCCACTGTATGAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-228s1c1
Sequence:CCGGGCACTGCATACTGAATCTAAACTCGAGTTTAGATTCAGTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-1080s1c1
Sequence:CCGGCATTCCTTAGAAGATCGTATTCTCGAGAATACGATCTTCTAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-561s1c1
Sequence:CCGGGCGGAGGCATTGCTAATGAAACTCGAGTTTCATTAGCAATGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-935s1c1
Sequence:CCGGGCTACAAAGATCCACCCACATCTCGAGATGTGGGTGGATCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029790
METTL15 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029790.1-1663s1c1
Sequence:CCGGCCATATTTCATACAGTGGAAACTCGAGTTTCCACTGTATGAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-228s1c1
Sequence:CCGGGCACTGCATACTGAATCTAAACTCGAGTTTAGATTCAGTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-1080s1c1
Sequence:CCGGCATTCCTTAGAAGATCGTATTCTCGAGAATACGATCTTCTAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-561s1c1
Sequence:CCGGGCGGAGGCATTGCTAATGAAACTCGAGTTTCATTAGCAATGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-935s1c1
Sequence:CCGGGCTACAAAGATCCACCCACATCTCGAGATGTGGGTGGATCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029790
METTL15 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029790.1-1663s1c1
Sequence:CCGGCCATATTTCATACAGTGGAAACTCGAGTTTCCACTGTATGAAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-228s1c1
Sequence:CCGGGCACTGCATACTGAATCTAAACTCGAGTTTAGATTCAGTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-1080s1c1
Sequence:CCGGCATTCCTTAGAAGATCGTATTCTCGAGAATACGATCTTCTAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-561s1c1
Sequence:CCGGGCGGAGGCATTGCTAATGAAACTCGAGTTTCATTAGCAATGCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029790.1-935s1c1
Sequence:CCGGGCTACAAAGATCCACCCACATCTCGAGATGTGGGTGGATCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks