EMAIL THIS PAGE TO A FRIEND

METTL16

methyltransferase like 16

Synonyms: METT10D
UniProtKB ID: Q86W50, D3DTI8, Q86TE5, Q96T16, Q9BVG7
Gene ID:
Mouse(67493) methyltransferase like 16
Rat(360568) methyltransferase like 16
Zebrafish(445217) methyltransferase like 16
cow(509278) methyltransferase like 16
Horse(100060313) methyltransferase like 16
domestic cat(101098176) methyltransferase like 16
dog(480655) methyltransferase like 16
chicken(431184) methyltransferase like 16
sheep(101118885) methyltransferase like 16
domestic guinea pig(100734997) methyltransferase like 16
naked mole-rat(101709207) methyltransferase like 16
Domestic Rabbit(100354377) methyltransferase like 16
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024086 Rosetta Predictions human pricing
XM_001080623 Rosetta Predictions rat pricing
XM_340844 Rosetta Predictions rat pricing
NM_026197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356556 predicted 1787
2 SASI_Hs01_00067245 predicted 1195
3 SASI_Hs01_00067246 predicted 1104
4 SASI_Hs02_00356557 predicted 201
5 SASI_Hs02_00356558 predicted 261
6 SASI_Hs01_00067250 predicted 1194
7 SASI_Hs01_00067251 predicted 1106
8 SASI_Hs01_00067252 predicted 1271
9 SASI_Hs02_00356559 predicted 1782
10 SASI_Hs01_00067253 predicted 310
11 SASI_Hs01_00067247 predicted 495
12 SASI_Hs01_00067248 predicted 527
13 SASI_Hs01_00067249 predicted 822
14 SASI_Hs01_00067254 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368690 predicted 610
2 SASI_Rn02_00368691 predicted 611
3 SASI_Rn02_00368692 predicted 970
4 SASI_Rn02_00368693 predicted 1046
5 SASI_Rn02_00368694 predicted 840
6 SASI_Rn02_00368695 predicted 1434
7 SASI_Rn02_00368696 predicted 583
8 SASI_Rn02_00368697 predicted 882
9 SASI_Rn02_00368698 predicted 1304
10 SASI_Rn02_00368699 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391999 predicted 1196
2 SASI_Rn02_00392000 predicted 1269
3 SASI_Rn02_00392001 predicted 1066
4 SASI_Rn02_00392002 predicted 1657
5 SASI_Rn02_00392003 predicted 244
6 SASI_Rn02_00392004 predicted 807
7 SASI_Rn02_00392005 predicted 205
8 SASI_Rn02_00392006 predicted 1107
9 SASI_Rn02_00392007 predicted 1529
10 SASI_Rn02_00392008 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329864 predicted 1132
2 SASI_Mm01_00158419 predicted 1145
3 SASI_Mm02_00329865 predicted 637
4 SASI_Mm01_00158420 predicted 217
5 SASI_Mm01_00158421 predicted 803
6 SASI_Mm01_00158422 predicted 1165
7 SASI_Mm01_00158423 predicted 1254
8 SASI_Mm01_00158424 predicted 313
9 SASI_Mm01_00158426 predicted 1687
10 SASI_Mm01_00158427 predicted 481
11 SASI_Mm01_00158425 predicted 560
12 SASI_Mm01_00158428 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026197
METTL16 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-487s1c1
Sequence:CCGGGCAACCTTAAATGGCTGGTATCTCGAGATACCAGCCATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-1742s1c1
Sequence:CCGGGCACTTACGTACGTAACCAAACTCGAGTTTGGTTACGTACGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-1044s1c1
Sequence:CCGGGCCAAGGAAACCCATTACTTTCTCGAGAAAGTAATGGGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-580s1c1
Sequence:CCGGGATCTCATTAAAGTGGTGAAACTCGAGTTTCACCACTTTAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026197.1-2547s1c1
Sequence:CCGGGCCTATTTCAGAACCAGAGTTCTCGAGAACTCTGGTTCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-819s1c2
Sequence:CCGGCCATGACAGTTTACAGCTCAACTCGAGTTGAGCTGTAAACTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.3-1176s1c1
Sequence:CCGGGATCTGAAGGTGCAACATAAGCTCGAGCTTATGTTGCACCTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026197
METTL16 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-487s1c1
Sequence:CCGGGCAACCTTAAATGGCTGGTATCTCGAGATACCAGCCATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-1742s1c1
Sequence:CCGGGCACTTACGTACGTAACCAAACTCGAGTTTGGTTACGTACGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-1044s1c1
Sequence:CCGGGCCAAGGAAACCCATTACTTTCTCGAGAAAGTAATGGGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-580s1c1
Sequence:CCGGGATCTCATTAAAGTGGTGAAACTCGAGTTTCACCACTTTAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026197.1-2547s1c1
Sequence:CCGGGCCTATTTCAGAACCAGAGTTCTCGAGAACTCTGGTTCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-819s1c2
Sequence:CCGGCCATGACAGTTTACAGCTCAACTCGAGTTGAGCTGTAAACTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.3-1176s1c1
Sequence:CCGGGATCTGAAGGTGCAACATAAGCTCGAGCTTATGTTGCACCTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026197
METTL16 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-487s1c1
Sequence:CCGGGCAACCTTAAATGGCTGGTATCTCGAGATACCAGCCATTTAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-1742s1c1
Sequence:CCGGGCACTTACGTACGTAACCAAACTCGAGTTTGGTTACGTACGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-1044s1c1
Sequence:CCGGGCCAAGGAAACCCATTACTTTCTCGAGAAAGTAATGGGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026197.1-580s1c1
Sequence:CCGGGATCTCATTAAAGTGGTGAAACTCGAGTTTCACCACTTTAATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026197.1-2547s1c1
Sequence:CCGGGCCTATTTCAGAACCAGAGTTCTCGAGAACTCTGGTTCTGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.1-819s1c2
Sequence:CCGGCCATGACAGTTTACAGCTCAACTCGAGTTGAGCTGTAAACTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026197.3-1176s1c1
Sequence:CCGGGATCTGAAGGTGCAACATAAGCTCGAGCTTATGTTGCACCTTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024086
METTL16 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 16
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-2822s1c1
Sequence:CCGGCGGAGTAACTGTGTCCTTGAACTCGAGTTCAAGGACACAGTTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-710s1c1
Sequence:CCGGCAAGGGAGTAAACTCACGAAACTCGAGTTTCGTGAGTTTACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2785s1c1
Sequence:CCGGCCTGTACTTACCTACTCACATCTCGAGATGTGAGTAGGTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-930s1c1
Sequence:CCGGCCCAAAGTAACGTACACTGAACTCGAGTTCAGTGTACGTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-3188s1c1
Sequence:CCGGGTTTGTTATGAGGTGGAGTTTCTCGAGAAACTCCACCTCATAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2571s1c1
Sequence:CCGGCATCTGAAGTAGAGCTTGTTTCTCGAGAAACAAGCTCTACTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-931s1c1
Sequence:CCGGCCAAAGTAACGTACACTGAATCTCGAGATTCAGTGTACGTTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-518s1c1
Sequence:CCGGCGCAACAGAAGTGGATGATATCTCGAGATATCATCCACTTCTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-493s1c1
Sequence:CCGGCAACCTTGAATGGCTGGTATTCTCGAGAATACCAGCCATTCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-1771s1c1
Sequence:CCGGGCACCTACATACGTAACCAAACTCGAGTTTGGTTACGTATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-1141s1c1
Sequence:CCGGGCATAGTCGTTGTCACGACATCTCGAGATGTCGTGACAACGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024086
METTL16 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 16
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-2822s1c1
Sequence:CCGGCGGAGTAACTGTGTCCTTGAACTCGAGTTCAAGGACACAGTTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-710s1c1
Sequence:CCGGCAAGGGAGTAAACTCACGAAACTCGAGTTTCGTGAGTTTACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2785s1c1
Sequence:CCGGCCTGTACTTACCTACTCACATCTCGAGATGTGAGTAGGTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-930s1c1
Sequence:CCGGCCCAAAGTAACGTACACTGAACTCGAGTTCAGTGTACGTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-3188s1c1
Sequence:CCGGGTTTGTTATGAGGTGGAGTTTCTCGAGAAACTCCACCTCATAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2571s1c1
Sequence:CCGGCATCTGAAGTAGAGCTTGTTTCTCGAGAAACAAGCTCTACTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-931s1c1
Sequence:CCGGCCAAAGTAACGTACACTGAATCTCGAGATTCAGTGTACGTTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-518s1c1
Sequence:CCGGCGCAACAGAAGTGGATGATATCTCGAGATATCATCCACTTCTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-493s1c1
Sequence:CCGGCAACCTTGAATGGCTGGTATTCTCGAGAATACCAGCCATTCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-1771s1c1
Sequence:CCGGGCACCTACATACGTAACCAAACTCGAGTTTGGTTACGTATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-1141s1c1
Sequence:CCGGGCATAGTCGTTGTCACGACATCTCGAGATGTCGTGACAACGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024086
METTL16 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 16
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-2822s1c1
Sequence:CCGGCGGAGTAACTGTGTCCTTGAACTCGAGTTCAAGGACACAGTTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-710s1c1
Sequence:CCGGCAAGGGAGTAAACTCACGAAACTCGAGTTTCGTGAGTTTACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2785s1c1
Sequence:CCGGCCTGTACTTACCTACTCACATCTCGAGATGTGAGTAGGTAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-930s1c1
Sequence:CCGGCCCAAAGTAACGTACACTGAACTCGAGTTCAGTGTACGTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024086.2-3188s1c1
Sequence:CCGGGTTTGTTATGAGGTGGAGTTTCTCGAGAAACTCCACCTCATAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-2571s1c1
Sequence:CCGGCATCTGAAGTAGAGCTTGTTTCTCGAGAAACAAGCTCTACTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-931s1c1
Sequence:CCGGCCAAAGTAACGTACACTGAATCTCGAGATTCAGTGTACGTTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024086.2-518s1c1
Sequence:CCGGCGCAACAGAAGTGGATGATATCTCGAGATATCATCCACTTCTGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-493s1c1
Sequence:CCGGCAACCTTGAATGGCTGGTATTCTCGAGAATACCAGCCATTCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024086.2-1771s1c1
Sequence:CCGGGCACCTACATACGTAACCAAACTCGAGTTTGGTTACGTATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024086.2-1141s1c1
Sequence:CCGGGCATAGTCGTTGTCACGACATCTCGAGATGTCGTGACAACGACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks