EMAIL THIS PAGE TO A FRIEND

METTL22

methyltransferase like 22

Synonyms: C16orf68
UniProtKB ID: Q9BUU2, B2RD29, D3DUF2, Q6XYB4, Q9HA03
Gene ID:
Mouse(239706) methyltransferase like 22
Rat(287054) methyltransferase like 22
Zebrafish(796066) methyltransferase like 22
cow(509540) methyltransferase like 22
Horse(100057604) methyltransferase like 22
domestic cat(101091071) methyltransferase like 22
dog(610231) methyltransferase like 22
chicken(425865) methyltransferase like 22
sheep(101105796) methyltransferase like 22
naked mole-rat(101712000) methyltransferase like 22
domestic guinea pig(100725153) methyltransferase like 22
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024109 Rosetta Predictions human pricing
XM_001078804 Rosetta Predictions rat pricing
XM_213210 Rosetta Predictions rat pricing
NM_146247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193677 predicted 755
2 SASI_Hs01_00193678 predicted 633
3 SASI_Hs01_00193680 predicted 1042
4 SASI_Hs01_00193681 predicted 337
5 SASI_Hs01_00193682 predicted 944
6 SASI_Hs01_00193683 predicted 356
7 SASI_Hs01_00193684 predicted 1164
8 SASI_Hs02_00356601 predicted 434
9 SASI_Hs01_00193685 predicted 294
10 SASI_Hs01_00193686 predicted 1003
11 SASI_Hs01_00193679 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362050 predicted 995
2 SASI_Rn02_00362051 predicted 785
3 SASI_Rn02_00362052 predicted 1127
4 SASI_Rn02_00362053 predicted 392
5 SASI_Rn02_00362054 predicted 979
6 SASI_Rn02_00362055 predicted 702
7 SASI_Rn02_00362056 predicted 758
8 SASI_Rn02_00362057 predicted 964
9 SASI_Rn02_00362058 predicted 662
10 SASI_Rn02_00362059 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374419 predicted 1581
2 SASI_Rn02_00374420 predicted 1005
3 SASI_Rn02_00374421 predicted 1567
4 SASI_Rn02_00374422 predicted 1333
5 SASI_Rn02_00374423 predicted 681
6 SASI_Rn02_00374424 predicted 1558
7 SASI_Rn02_00374425 predicted 1017
8 SASI_Rn02_00374426 predicted 776
9 SASI_Rn02_00374427 predicted 786
10 SASI_Rn02_00374428 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188089 predicted 605
2 SASI_Mm01_00188090 predicted 938
3 SASI_Mm02_00341981 predicted 735
4 SASI_Mm01_00188092 predicted 615
5 SASI_Mm01_00188093 predicted 934
6 SASI_Mm01_00188094 predicted 955
7 SASI_Mm01_00188095 predicted 722
8 SASI_Mm01_00188096 predicted 598
9 SASI_Mm01_00188097 predicted 200
10 SASI_Mm01_00188098 predicted 475
11 SASI_Mm01_00188091 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146247
VALIDATED
METTL22 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 22
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-308s21c1
Sequence:CCGGTGGCCACAGTCATGAGGATTTCTCGAGAAATCCTCATGACTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-116s21c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-960s21c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146247.1-614s21c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-939s21c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-614s1c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-720s1c1
Sequence:CCGGCACACCGTTTATTGTACAGATCTCGAGATCTGTACAATAAACGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-116s1c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-939s1c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146247.1-960s1c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146247
VALIDATED
METTL22 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 22
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-308s21c1
Sequence:CCGGTGGCCACAGTCATGAGGATTTCTCGAGAAATCCTCATGACTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-116s21c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-960s21c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146247.1-614s21c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-939s21c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-614s1c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-720s1c1
Sequence:CCGGCACACCGTTTATTGTACAGATCTCGAGATCTGTACAATAAACGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-116s1c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-939s1c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146247.1-960s1c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146247
VALIDATED
METTL22 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 22
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-308s21c1
Sequence:CCGGTGGCCACAGTCATGAGGATTTCTCGAGAAATCCTCATGACTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-116s21c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-960s21c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146247.1-614s21c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146247.1-939s21c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-614s1c1
Sequence:CCGGCCTGGCAGACTATATCCTGTTCTCGAGAACAGGATATAGTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-720s1c1
Sequence:CCGGCACACCGTTTATTGTACAGATCTCGAGATCTGTACAATAAACGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-116s1c1
Sequence:CCGGGCTGTCAGATGTCCACCTGTACTCGAGTACAGGTGGACATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146247.1-939s1c1
Sequence:CCGGGCCGAAGTGTTCTACGATGATCTCGAGATCATCGTAGAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146247.1-960s1c1
Sequence:CCGGGACTTAACCAACGCTCTGTTTCTCGAGAAACAGAGCGTTGGTTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024109
VALIDATED
METTL22 MISSION shRNA Bacterial Glycerol Stock
methyltransferase like 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-338s21c1
Sequence:CCGGTGTCAGATGTCCACCTCTATACTCGAGTATAGAGGTGGACATCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-302s21c1
Sequence:CCGGCCATGGACGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-1041s21c1
Sequence:CCGGCACTGGAGGTGGTATAGTTAGCTCGAGCTAACTATACCACCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-950s21c1
Sequence:CCGGCCATGGCACGGACCGTTTATTCTCGAGAATAAACGGTCCGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-769s21c1
Sequence:CCGGCCGCACGATATCATCAGAATACTCGAGTATTCTGATGATATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024109
VALIDATED
METTL22 MISSION shRNA shRNA Plasmid DNA
methyltransferase like 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-338s21c1
Sequence:CCGGTGTCAGATGTCCACCTCTATACTCGAGTATAGAGGTGGACATCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-302s21c1
Sequence:CCGGCCATGGACGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-1041s21c1
Sequence:CCGGCACTGGAGGTGGTATAGTTAGCTCGAGCTAACTATACCACCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-950s21c1
Sequence:CCGGCCATGGCACGGACCGTTTATTCTCGAGAATAAACGGTCCGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-769s21c1
Sequence:CCGGCCGCACGATATCATCAGAATACTCGAGTATTCTGATGATATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024109
VALIDATED
METTL22 MISSION shRNA Lentiviral Transduction Particles
methyltransferase like 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-338s21c1
Sequence:CCGGTGTCAGATGTCCACCTCTATACTCGAGTATAGAGGTGGACATCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-302s21c1
Sequence:CCGGCCATGGACGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-1041s21c1
Sequence:CCGGCACTGGAGGTGGTATAGTTAGCTCGAGCTAACTATACCACCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024109.2-950s21c1
Sequence:CCGGCCATGGCACGGACCGTTTATTCTCGAGAATAAACGGTCCGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024109.2-769s21c1
Sequence:CCGGCCGCACGATATCATCAGAATACTCGAGTATTCTGATGATATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks