EMAIL THIS PAGE TO A FRIEND

MFNG

MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase

UniProtKB ID: O00587, B4DLT6, O43730, Q504S9
Gene ID:
Human(4242) Summary: This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
Mouse(17305) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Rat(315119) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
sheep(101103554) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
naked mole-rat(101722987) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
domestic guinea pig(100731745) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Zebrafish(493633) manic fringe homolog
cow(505267) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
domestic cat(101097256) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
dog(610303) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
chicken(418042) MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002405 Rosetta Predictions human pricing
NM_199110 Rosetta Predictions rat pricing
NM_008595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230939 predicted 867
2 SASI_Hs01_00230940 predicted 1148
3 SASI_Hs01_00230941 predicted 681
4 SASI_Hs01_00230942 predicted 841
5 SASI_Hs01_00230945 predicted 759
6 SASI_Hs01_00230946 predicted 1202
7 SASI_Hs01_00230947 predicted 875
8 SASI_Hs01_00230948 predicted 1126
9 SASI_Hs02_00333778 predicted 328
10 SASI_Hs02_00333779 predicted 232
11 SASI_Hs01_00230943 predicted 447
12 SASI_Hs01_00230944 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060085 predicted 1075
2 SASI_Rn01_00060087 predicted 1378
3 SASI_Rn01_00060088 predicted 554
4 SASI_Rn02_00270130 predicted 1375
5 SASI_Rn02_00270131 predicted 471
6 SASI_Rn01_00060090 predicted 367
7 SASI_Rn02_00270132 predicted 1405
8 SASI_Rn01_00060091 predicted 801
9 SASI_Rn01_00060093 predicted 462
10 SASI_Rn01_00060094 predicted 1202
11 SASI_Rn01_00060086 predicted 460
12 SASI_Rn01_00060089 predicted 1244
13 SASI_Rn01_00060092 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031437 predicted 1152
2 SASI_Mm01_00031438 predicted 1302
3 SASI_Mm01_00031439 predicted 879
4 SASI_Mm01_00031441 predicted 446
5 SASI_Mm01_00031446 predicted 658
6 SASI_Mm02_00314241 predicted 432
7 SASI_Mm02_00314242 predicted 234
8 SASI_Mm02_00314243 predicted 330
9 SASI_Mm02_00314244 predicted 250
10 SASI_Mm02_00314245 predicted 414
11 SASI_Mm01_00031440 predicted 1163
12 SASI_Mm01_00031442 predicted 416
13 SASI_Mm01_00031443 predicted 1297
14 SASI_Mm01_00031444 predicted 530
15 SASI_Mm01_00031445 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008595
MFNG MISSION shRNA Bacterial Glycerol Stock
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008595.1-1646s1c1
Sequence:CCGGGCAAAGCCAATAGAAGGGTTTCTCGAGAAACCCTTCTATTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-241s1c1
Sequence:CCGGCTCTACGATACCACTCAAGTTCTCGAGAACTTGAGTGGTATCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-238s1c1
Sequence:CCGGTGTCTCTACGATACCACTCAACTCGAGTTGAGTGGTATCGTAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-833s1c1
Sequence:CCGGTGTGGACACTTCTGCTCTCATCTCGAGATGAGAGCAGAAGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-419s1c1
Sequence:CCGGCAGGCAACAGACATTCATCTTCTCGAGAAGATGAATGTCTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008595
MFNG MISSION shRNA shRNA Plasmid DNA
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008595.1-1646s1c1
Sequence:CCGGGCAAAGCCAATAGAAGGGTTTCTCGAGAAACCCTTCTATTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-241s1c1
Sequence:CCGGCTCTACGATACCACTCAAGTTCTCGAGAACTTGAGTGGTATCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-238s1c1
Sequence:CCGGTGTCTCTACGATACCACTCAACTCGAGTTGAGTGGTATCGTAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-833s1c1
Sequence:CCGGTGTGGACACTTCTGCTCTCATCTCGAGATGAGAGCAGAAGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-419s1c1
Sequence:CCGGCAGGCAACAGACATTCATCTTCTCGAGAAGATGAATGTCTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008595
MFNG MISSION shRNA Lentiviral Transduction Particles
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008595.1-1646s1c1
Sequence:CCGGGCAAAGCCAATAGAAGGGTTTCTCGAGAAACCCTTCTATTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-241s1c1
Sequence:CCGGCTCTACGATACCACTCAAGTTCTCGAGAACTTGAGTGGTATCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-238s1c1
Sequence:CCGGTGTCTCTACGATACCACTCAACTCGAGTTGAGTGGTATCGTAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-833s1c1
Sequence:CCGGTGTGGACACTTCTGCTCTCATCTCGAGATGAGAGCAGAAGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008595.1-419s1c1
Sequence:CCGGCAGGCAACAGACATTCATCTTCTCGAGAAGATGAATGTCTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002405
MFNG MISSION shRNA Bacterial Glycerol Stock
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002405.2-1841s1c1
Sequence:CCGGGCAAATCCAATAGAGATGTTTCTCGAGAAACATCTCTATTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-820s1c1
Sequence:CCGGGCTCCCGTTTCATGGACACATCTCGAGATGTGTCCATGAAACGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-1083s1c1
Sequence:CCGGCATTGTCTGCTCTATCCAGATCTCGAGATCTGGATAGAGCAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-315s1c1
Sequence:CCGGCCTAAGCTACAGCTACACGATCTCGAGATCGTGTAGCTGTAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-862s21c1
Sequence:CCGGGCTTCTGCATCAATCGCAAACCTCGAGGTTTGCGATTGATGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-1104s21c1
Sequence:CCGGGGGAAACTCAACGTCATTAAGCTCGAGCTTAATGACGTTGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002405
MFNG MISSION shRNA shRNA Plasmid DNA
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002405.2-1841s1c1
Sequence:CCGGGCAAATCCAATAGAGATGTTTCTCGAGAAACATCTCTATTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-820s1c1
Sequence:CCGGGCTCCCGTTTCATGGACACATCTCGAGATGTGTCCATGAAACGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-1083s1c1
Sequence:CCGGCATTGTCTGCTCTATCCAGATCTCGAGATCTGGATAGAGCAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-315s1c1
Sequence:CCGGCCTAAGCTACAGCTACACGATCTCGAGATCGTGTAGCTGTAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-862s21c1
Sequence:CCGGGCTTCTGCATCAATCGCAAACCTCGAGGTTTGCGATTGATGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-1104s21c1
Sequence:CCGGGGGAAACTCAACGTCATTAAGCTCGAGCTTAATGACGTTGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002405
MFNG MISSION shRNA Lentiviral Transduction Particles
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002405.2-1841s1c1
Sequence:CCGGGCAAATCCAATAGAGATGTTTCTCGAGAAACATCTCTATTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-820s1c1
Sequence:CCGGGCTCCCGTTTCATGGACACATCTCGAGATGTGTCCATGAAACGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-1083s1c1
Sequence:CCGGCATTGTCTGCTCTATCCAGATCTCGAGATCTGGATAGAGCAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002405.2-315s1c1
Sequence:CCGGCCTAAGCTACAGCTACACGATCTCGAGATCGTGTAGCTGTAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-862s21c1
Sequence:CCGGGCTTCTGCATCAATCGCAAACCTCGAGGTTTGCGATTGATGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002405.3-1104s21c1
Sequence:CCGGGGGAAACTCAACGTCATTAAGCTCGAGCTTAATGACGTTGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks