EMAIL THIS PAGE TO A FRIEND

MFSD12

major facilitator superfamily domain containing 12

Synonyms: C19orf28 PP3501
UniProtKB ID: Q6NUT3, A8MXP7, D6W615, E9PAJ8, Q8N459
Gene ID:
Mouse(73822) major facilitator superfamily domain containing 12
Rat(362824) major facilitator superfamily domain containing 12
sheep(101116566) major facilitator superfamily domain containing 12
domestic guinea pig(100716764) major facilitator superfamily domain containing 12
naked mole-rat(101726618) major facilitator superfamily domain containing 12
cow(526668) major facilitator superfamily domain containing 12
domestic cat(101088306) major facilitator superfamily domain containing 12
dog(485058) major facilitator superfamily domain containing 12
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174983 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152101 MISSION® esiRNA esiRNA human C19orf28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042680 Rosetta Predictions human pricing
NM_021731 Rosetta Predictions human pricing
NM_174983 Rosetta Predictions human pricing
NM_001108730 Rosetta Predictions rat pricing
XM_343152 Rosetta Predictions rat pricing
NM_028657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310943 predicted 1008
2 SASI_Hs02_00310944 predicted 560
3 SASI_Hs02_00310945 predicted 1092
4 SASI_Hs02_00310946 predicted 545
5 SASI_Hs02_00310947 predicted 852
6 SASI_Hs02_00310948 predicted 669
7 SASI_Hs02_00310949 predicted 1052
8 SASI_Hs02_00310950 predicted 636
9 SASI_Hs02_00310951 predicted 1316
10 SASI_Hs02_00310952 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355048 predicted 1002
2 SASI_Hs02_00355049 predicted 562
3 SASI_Hs02_00355050 predicted 1090
4 SASI_Hs02_00355051 predicted 551
5 SASI_Hs02_00355052 predicted 854
6 SASI_Hs02_00355053 predicted 671
7 SASI_Hs02_00355054 predicted 1047
8 SASI_Hs02_00355055 predicted 637
9 SASI_Hs02_00355056 predicted 1313
10 SASI_Hs02_00355057 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123972 predicted 1008
2 SASI_Hs01_00123974 predicted 565
3 SASI_Hs02_00368927 predicted 1086
4 SASI_Hs02_00368928 predicted 544
5 SASI_Hs01_00123976 predicted 848
6 SASI_Hs01_00123977 predicted 671
7 SASI_Hs01_00123978 predicted 1053
8 SASI_Hs02_00368929 predicted 641
9 SASI_Hs02_00368930 predicted 1310
10 SASI_Hs02_00368931 predicted 1326
11 SASI_Hs01_00123973 predicted 1356
12 SASI_Hs01_00123975 predicted 1561
13 SASI_Hs01_00123979 predicted 1053
14 SASI_Hs01_00123980 predicted 1382
15 SASI_Hs01_00123981 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241515 predicted 900
2 SASI_Rn02_00241516 predicted 893
3 SASI_Rn02_00241517 predicted 1017
4 SASI_Rn02_00241518 predicted 1564
5 SASI_Rn02_00241519 predicted 1487
6 SASI_Rn02_00241520 predicted 627
7 SASI_Rn02_00241521 predicted 905
8 SASI_Rn02_00241522 predicted 1403
9 SASI_Rn02_00241523 predicted 821
10 SASI_Rn02_00241524 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159063 predicted 659
2 SASI_Rn01_00159064 predicted 962
3 SASI_Rn01_00159065 predicted 323
4 SASI_Rn01_00159066 predicted 774
5 SASI_Rn01_00159067 predicted 557
6 SASI_Rn01_00159068 predicted 382
7 SASI_Rn01_00159069 predicted 668
8 SASI_Rn01_00159070 predicted 1009
9 SASI_Rn01_00159071 predicted 619
10 SASI_Rn01_00159072 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334180 predicted 1208
2 SASI_Mm02_00334181 predicted 928
3 SASI_Mm01_00169964 predicted 889
4 SASI_Mm02_00334182 predicted 613
5 SASI_Mm01_00169965 predicted 899
6 SASI_Mm01_00169967 predicted 1025
7 SASI_Mm01_00169968 predicted 850
8 SASI_Mm01_00169969 predicted 1022
9 SASI_Mm01_00169970 predicted 529
10 SASI_Mm01_00169971 predicted 1403
11 SASI_Mm01_00169963 predicted 1792
12 SASI_Mm01_00169966 predicted 1286
13 SASI_Mm01_00169972 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028657
VALIDATED
MFSD12 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-867s21c1
Sequence:CCGGACATGACCACAAGGCTCATTGCTCGAGCAATGAGCCTTGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-891s21c1
Sequence:CCGGACCTGTCTCAGACCTACATTGCTCGAGCAATGTAGGTCTGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1212s21c1
Sequence:CCGGACAGTGGAGCCTTCGTGTATGCTCGAGCATACACGAAGGCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1479s21c1
Sequence:CCGGACGTTATGAAGGACCAGGCAGCTCGAGCTGCCTGGTCCTTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028657.3-143s21c1
Sequence:CCGGTTCACCTACCTGCTACTATTCCTCGAGGAATAGTAGCAGGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028657
VALIDATED
MFSD12 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-867s21c1
Sequence:CCGGACATGACCACAAGGCTCATTGCTCGAGCAATGAGCCTTGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-891s21c1
Sequence:CCGGACCTGTCTCAGACCTACATTGCTCGAGCAATGTAGGTCTGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1212s21c1
Sequence:CCGGACAGTGGAGCCTTCGTGTATGCTCGAGCATACACGAAGGCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1479s21c1
Sequence:CCGGACGTTATGAAGGACCAGGCAGCTCGAGCTGCCTGGTCCTTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028657.3-143s21c1
Sequence:CCGGTTCACCTACCTGCTACTATTCCTCGAGGAATAGTAGCAGGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028657
VALIDATED
MFSD12 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-867s21c1
Sequence:CCGGACATGACCACAAGGCTCATTGCTCGAGCAATGAGCCTTGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-891s21c1
Sequence:CCGGACCTGTCTCAGACCTACATTGCTCGAGCAATGTAGGTCTGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1212s21c1
Sequence:CCGGACAGTGGAGCCTTCGTGTATGCTCGAGCATACACGAAGGCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028657.3-1479s21c1
Sequence:CCGGACGTTATGAAGGACCAGGCAGCTCGAGCTGCCTGGTCCTTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028657.3-143s21c1
Sequence:CCGGTTCACCTACCTGCTACTATTCCTCGAGGAATAGTAGCAGGTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174983
VALIDATED
MFSD12 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 12
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1138s1c1
Sequence:CCGGCAAGTGCATTGGGAGGAACATCTCGAGATGTTCCTCCCAATGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1785s1c1
Sequence:CCGGCCCATTCTCAACTCTAATCCACTCGAGTGGATTAGAGTTGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1126s1c1
Sequence:CCGGGAAGCCCATCAACAAGTGCATCTCGAGATGCACTTGTTGATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1105s1c1
Sequence:CCGGCTTCTTGTCCTCCTTCCTCATCTCGAGATGAGGAAGGAGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1131s1c1
Sequence:CCGGCCATCAACAAGTGCATTGGGACTCGAGTCCCAATGCACTTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1117s1c1
Sequence:CCGGCTTCCTCATGAAGCCCATCAACTCGAGTTGATGGGCTTCATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1120s1c1
Sequence:CCGGCCTCATGAAGCCCATCAACAACTCGAGTTGTTGATGGGCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1135s1c1
Sequence:CCGGCAACAAGTGCATTGGGAGGAACTCGAGTTCCTCCCAATGCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1350s1c1
Sequence:CCGGGCTCCATGAGCTTCTTGGATACTCGAGTATCCAAGAAGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1060s1c1
Sequence:CCGGCAAGAAGTTCATCGCGACCATCTCGAGATGGTCGCGATGAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-975s1c1
Sequence:CCGGGCATACTGTACATGACCACCACTCGAGTGGTGGTCATGTACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174983
VALIDATED
MFSD12 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 12
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1138s1c1
Sequence:CCGGCAAGTGCATTGGGAGGAACATCTCGAGATGTTCCTCCCAATGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1785s1c1
Sequence:CCGGCCCATTCTCAACTCTAATCCACTCGAGTGGATTAGAGTTGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1126s1c1
Sequence:CCGGGAAGCCCATCAACAAGTGCATCTCGAGATGCACTTGTTGATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1105s1c1
Sequence:CCGGCTTCTTGTCCTCCTTCCTCATCTCGAGATGAGGAAGGAGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1131s1c1
Sequence:CCGGCCATCAACAAGTGCATTGGGACTCGAGTCCCAATGCACTTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1117s1c1
Sequence:CCGGCTTCCTCATGAAGCCCATCAACTCGAGTTGATGGGCTTCATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1120s1c1
Sequence:CCGGCCTCATGAAGCCCATCAACAACTCGAGTTGTTGATGGGCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1135s1c1
Sequence:CCGGCAACAAGTGCATTGGGAGGAACTCGAGTTCCTCCCAATGCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1350s1c1
Sequence:CCGGGCTCCATGAGCTTCTTGGATACTCGAGTATCCAAGAAGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1060s1c1
Sequence:CCGGCAAGAAGTTCATCGCGACCATCTCGAGATGGTCGCGATGAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-975s1c1
Sequence:CCGGGCATACTGTACATGACCACCACTCGAGTGGTGGTCATGTACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174983
VALIDATED
MFSD12 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 12
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1138s1c1
Sequence:CCGGCAAGTGCATTGGGAGGAACATCTCGAGATGTTCCTCCCAATGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1785s1c1
Sequence:CCGGCCCATTCTCAACTCTAATCCACTCGAGTGGATTAGAGTTGAGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1126s1c1
Sequence:CCGGGAAGCCCATCAACAAGTGCATCTCGAGATGCACTTGTTGATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1105s1c1
Sequence:CCGGCTTCTTGTCCTCCTTCCTCATCTCGAGATGAGGAAGGAGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1131s1c1
Sequence:CCGGCCATCAACAAGTGCATTGGGACTCGAGTCCCAATGCACTTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1117s1c1
Sequence:CCGGCTTCCTCATGAAGCCCATCAACTCGAGTTGATGGGCTTCATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1120s1c1
Sequence:CCGGCCTCATGAAGCCCATCAACAACTCGAGTTGTTGATGGGCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174983.2-1135s1c1
Sequence:CCGGCAACAAGTGCATTGGGAGGAACTCGAGTTCCTCCCAATGCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-1350s1c1
Sequence:CCGGGCTCCATGAGCTTCTTGGATACTCGAGTATCCAAGAAGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_174983.2-1060s1c1
Sequence:CCGGCAAGAAGTTCATCGCGACCATCTCGAGATGGTCGCGATGAACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174983.2-975s1c1
Sequence:CCGGGCATACTGTACATGACCACCACTCGAGTGGTGGTCATGTACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks