EMAIL THIS PAGE TO A FRIEND

MFSD3

major facilitator superfamily domain containing 3

UniProtKB ID: Q96ES6
Gene ID:
Mouse(69572) major facilitator superfamily domain containing 3
Rat(500899) major facilitator superfamily domain containing 3
naked mole-rat(101711227) major facilitator superfamily domain containing 3
domestic guinea pig(100735805) major facilitator superfamily domain containing 3
sheep(101107290) major facilitator superfamily domain containing 3
domestic cat(101097454) major facilitator superfamily domain containing 3
dog(482100) major facilitator superfamily domain containing 3
cow(508702) major facilitator superfamily domain containing 3
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138431 Rosetta Predictions human pricing
NM_001024908 Rosetta Predictions rat pricing
NM_027122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223913 predicted 1098
2 SASI_Hs01_00223914 predicted 1087
3 SASI_Hs01_00223915 predicted 1087
4 SASI_Hs01_00223916 predicted 1132
5 SASI_Hs02_00363584 predicted 817
6 SASI_Hs02_00363585 predicted 815
7 SASI_Hs01_00223919 predicted 1124
8 SASI_Hs02_00363586 predicted 869
9 SASI_Hs02_00363587 predicted 1123
10 SASI_Hs01_00223922 predicted 1135
11 SASI_Hs01_00223917 predicted 1054
12 SASI_Hs01_00223918 predicted 1047
13 SASI_Hs01_00223920 predicted 893
14 SASI_Hs01_00223921 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105413 predicted 509
2 SASI_Rn01_00105414 predicted 458
3 SASI_Rn01_00105415 predicted 719
4 SASI_Rn01_00105416 predicted 929
5 SASI_Rn01_00105417 predicted 1095
6 SASI_Rn01_00105419 predicted 316
7 SASI_Rn01_00105420 predicted 258
8 SASI_Rn01_00105421 predicted 1085
9 SASI_Rn01_00105422 predicted 1221
10 SASI_Rn02_00202809 predicted 1208
11 SASI_Rn01_00105418 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178025 predicted 1369
2 SASI_Mm01_00178026 predicted 731
3 SASI_Mm02_00331589 predicted 1195
4 SASI_Mm01_00178027 predicted 1095
5 SASI_Mm01_00178028 predicted 1432
6 SASI_Mm01_00178029 predicted 783
7 SASI_Mm01_00178032 predicted 1403
8 SASI_Mm01_00178033 predicted 1384
9 SASI_Mm01_00178034 predicted 252
10 SASI_Mm02_00331590 predicted 1369
11 SASI_Mm01_00178030 predicted 608
12 SASI_Mm01_00178031 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027122
MFSD3 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-1155s21c1
Sequence:CCGGTGATGCACTGTAGCCAGCTAGCTCGAGCTAGCTGGCTACAGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027122.3-1451s21c1
Sequence:CCGGTCAAACTGAAGGCTATGTTACCTCGAGGTAACATAGCCTTCAGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-265s21c1
Sequence:CCGGGTATGCTCCATGGCTGTTAAACTCGAGTTTAACAGCCATGGAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1094s1c1
Sequence:CCGGGCTAAGCCTATGTCTACAACACTCGAGTGTTGTAGACATAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-733s1c1
Sequence:CCGGGCTCCTATCTTCTACAAGATTCTCGAGAATCTTGTAGAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1190s1c1
Sequence:CCGGGCAGGCTACACATTACAGCTTCTCGAGAAGCTGTAATGTGTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-332s1c1
Sequence:CCGGCTGGTTAACACTCAGCACACTCTCGAGAGTGTGCTGAGTGTTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027122
MFSD3 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-1155s21c1
Sequence:CCGGTGATGCACTGTAGCCAGCTAGCTCGAGCTAGCTGGCTACAGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027122.3-1451s21c1
Sequence:CCGGTCAAACTGAAGGCTATGTTACCTCGAGGTAACATAGCCTTCAGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-265s21c1
Sequence:CCGGGTATGCTCCATGGCTGTTAAACTCGAGTTTAACAGCCATGGAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1094s1c1
Sequence:CCGGGCTAAGCCTATGTCTACAACACTCGAGTGTTGTAGACATAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-733s1c1
Sequence:CCGGGCTCCTATCTTCTACAAGATTCTCGAGAATCTTGTAGAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1190s1c1
Sequence:CCGGGCAGGCTACACATTACAGCTTCTCGAGAAGCTGTAATGTGTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-332s1c1
Sequence:CCGGCTGGTTAACACTCAGCACACTCTCGAGAGTGTGCTGAGTGTTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027122
MFSD3 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-1155s21c1
Sequence:CCGGTGATGCACTGTAGCCAGCTAGCTCGAGCTAGCTGGCTACAGTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027122.3-1451s21c1
Sequence:CCGGTCAAACTGAAGGCTATGTTACCTCGAGGTAACATAGCCTTCAGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027122.3-265s21c1
Sequence:CCGGGTATGCTCCATGGCTGTTAAACTCGAGTTTAACAGCCATGGAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1094s1c1
Sequence:CCGGGCTAAGCCTATGTCTACAACACTCGAGTGTTGTAGACATAGGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-733s1c1
Sequence:CCGGGCTCCTATCTTCTACAAGATTCTCGAGAATCTTGTAGAAGATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-1190s1c1
Sequence:CCGGGCAGGCTACACATTACAGCTTCTCGAGAAGCTGTAATGTGTAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027122.2-332s1c1
Sequence:CCGGCTGGTTAACACTCAGCACACTCTCGAGAGTGTGCTGAGTGTTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138431
VALIDATED
MFSD3 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-823s21c1
Sequence:CCGGGGCTTTGTGCTCACCTACAAGCTCGAGCTTGTAGGTGAGCACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-1123s21c1
Sequence:CCGGTCAGCCTTGCTGAGCCTATGTCTCGAGACATAGGCTCAGCAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-646s21c1
Sequence:CCGGTTCTCGTGGCCGCAACTCTTTCTCGAGAAAGAGTTGCGGCCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-1095s21c1
Sequence:CCGGCATGGACGCTGGCACAATCTTCTCGAGAAGATTGTGCCAGCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138431
VALIDATED
MFSD3 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-823s21c1
Sequence:CCGGGGCTTTGTGCTCACCTACAAGCTCGAGCTTGTAGGTGAGCACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-1123s21c1
Sequence:CCGGTCAGCCTTGCTGAGCCTATGTCTCGAGACATAGGCTCAGCAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-646s21c1
Sequence:CCGGTTCTCGTGGCCGCAACTCTTTCTCGAGAAAGAGTTGCGGCCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-1095s21c1
Sequence:CCGGCATGGACGCTGGCACAATCTTCTCGAGAAGATTGTGCCAGCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138431
VALIDATED
MFSD3 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-823s21c1
Sequence:CCGGGGCTTTGTGCTCACCTACAAGCTCGAGCTTGTAGGTGAGCACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-1123s21c1
Sequence:CCGGTCAGCCTTGCTGAGCCTATGTCTCGAGACATAGGCTCAGCAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138431.1-646s21c1
Sequence:CCGGTTCTCGTGGCCGCAACTCTTTCTCGAGAAAGAGTTGCGGCCACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138431.1-1095s21c1
Sequence:CCGGCATGGACGCTGGCACAATCTTCTCGAGAAGATTGTGCCAGCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks