EMAIL THIS PAGE TO A FRIEND

MGAT3

mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase

Synonyms: GNT-III GNT3
UniProtKB ID: Q09327, A6NGD0, Q14CK5, Q6IC49, Q9UH32
Gene ID:
Human(4248) Summary: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. The enzyme encoded by this gene transfers a GlcNAc residue to the beta-linked mannose of the trimannosyl core of N-linked oligosaccharides and produces a bisecting GlcNAc. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(17309) mannoside acetylglucosaminyltransferase 3
Rat(29582) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
sheep(101123204) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
naked mole-rat(101726123) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
domestic guinea pig(101787507) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
chicken(418013) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
dog(481244) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
domestic cat(101096819) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Horse(100055333) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
cow(520087) mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138911 MISSION® esiRNA esiRNA human MGAT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098270 Rosetta Predictions human pricing
NM_002409 Rosetta Predictions human pricing
NM_019239 Rosetta Predictions rat pricing
NM_010795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318758 predicted 1151
2 SASI_Hs02_00318759 predicted 835
3 SASI_Hs02_00318760 predicted 2207
4 SASI_Hs02_00318761 predicted 2216
5 SASI_Hs02_00318762 predicted 911
6 SASI_Hs02_00318763 predicted 869
7 SASI_Hs02_00318764 predicted 887
8 SASI_Hs02_00318765 predicted 1396
9 SASI_Hs02_00318766 predicted 975
10 SASI_Hs02_00318767 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081709 predicted 1268
2 SASI_Hs01_00081711 predicted 952
3 SASI_Hs02_00333785 predicted 2324
4 SASI_Hs02_00333786 predicted 2331
5 SASI_Hs01_00081712 predicted 1029
6 SASI_Hs01_00081713 predicted 986
7 SASI_Hs01_00081714 predicted 1005
8 SASI_Hs01_00081715 predicted 1518
9 SASI_Hs01_00081716 predicted 1091
10 SASI_Hs02_00333787 predicted 1030
11 SASI_Hs01_00081710 predicted 875
12 SASI_Hs01_00081717 predicted 733
13 SASI_Hs01_00081718 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116264 predicted 1975
2 SASI_Rn01_00116265 predicted 1339
3 SASI_Rn01_00116266 predicted 301
4 SASI_Rn01_00116267 predicted 749
5 SASI_Rn01_00116268 predicted 1871
6 SASI_Rn01_00116269 predicted 2104
7 SASI_Rn02_00262110 predicted 987
8 SASI_Rn01_00116270 predicted 2124
9 SASI_Rn01_00116272 predicted 1402
10 SASI_Rn02_00262111 predicted 1493
11 SASI_Rn01_00116263 predicted 700
12 SASI_Rn01_00116271 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122483 predicted 1574
2 SASI_Mm02_00319366 predicted 1373
3 SASI_Mm01_00122484 predicted 1573
4 SASI_Mm01_00122485 predicted 1404
5 SASI_Mm01_00122486 predicted 2028
6 SASI_Mm01_00122487 predicted 2140
7 SASI_Mm01_00122488 predicted 759
8 SASI_Mm01_00122489 predicted 812
9 SASI_Mm01_00122490 predicted 1299
10 SASI_Mm01_00122491 predicted 1172
11 SASI_Mm01_00122492 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002409
MGAT3 MISSION shRNA Bacterial Glycerol Stock
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-874s21c1
Sequence:CCGGTCAACGTCAACCACGAGTTCGCTCGAGCGAACTCGTGGTTGACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-1274s21c1
Sequence:CCGGCAAGTCGCTCTACGGCTTCTTCTCGAGAAGAAGCCGTAGAGCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-955s1c1
Sequence:CCGGGAGTCCAACTTCACGGCTTATCTCGAGATAAGCCGTGAAGTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1395s1c1
Sequence:CCGGGTACTACACCATGCCCAACTTCTCGAGAAGTTGGGCATGGTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-294s1c1
Sequence:CCGGCCTCATCTCCTTCCTGCACTTCTCGAGAAGTGCAGGAAGGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1171s1c1
Sequence:CCGGGACGTCTTCATCATTGACGATCTCGAGATCGTCAATGATGAAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-543s1c1
Sequence:CCGGCGAGGACACCACCGAGTATTTCTCGAGAAATACTCGGTGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002409
MGAT3 MISSION shRNA shRNA Plasmid DNA
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-874s21c1
Sequence:CCGGTCAACGTCAACCACGAGTTCGCTCGAGCGAACTCGTGGTTGACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-1274s21c1
Sequence:CCGGCAAGTCGCTCTACGGCTTCTTCTCGAGAAGAAGCCGTAGAGCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-955s1c1
Sequence:CCGGGAGTCCAACTTCACGGCTTATCTCGAGATAAGCCGTGAAGTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1395s1c1
Sequence:CCGGGTACTACACCATGCCCAACTTCTCGAGAAGTTGGGCATGGTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-294s1c1
Sequence:CCGGCCTCATCTCCTTCCTGCACTTCTCGAGAAGTGCAGGAAGGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1171s1c1
Sequence:CCGGGACGTCTTCATCATTGACGATCTCGAGATCGTCAATGATGAAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-543s1c1
Sequence:CCGGCGAGGACACCACCGAGTATTTCTCGAGAAATACTCGGTGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002409
MGAT3 MISSION shRNA Lentiviral Transduction Particles
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-874s21c1
Sequence:CCGGTCAACGTCAACCACGAGTTCGCTCGAGCGAACTCGTGGTTGACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002409.4-1274s21c1
Sequence:CCGGCAAGTCGCTCTACGGCTTCTTCTCGAGAAGAAGCCGTAGAGCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-955s1c1
Sequence:CCGGGAGTCCAACTTCACGGCTTATCTCGAGATAAGCCGTGAAGTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1395s1c1
Sequence:CCGGGTACTACACCATGCCCAACTTCTCGAGAAGTTGGGCATGGTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-294s1c1
Sequence:CCGGCCTCATCTCCTTCCTGCACTTCTCGAGAAGTGCAGGAAGGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-1171s1c1
Sequence:CCGGGACGTCTTCATCATTGACGATCTCGAGATCGTCAATGATGAAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002409.3-543s1c1
Sequence:CCGGCGAGGACACCACCGAGTATTTCTCGAGAAATACTCGGTGGTGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010795
VALIDATED
MGAT3 MISSION shRNA Bacterial Glycerol Stock
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1502s1c1
Sequence:CCGGGCTCAAGAACTATGACCAGTTCTCGAGAACTGGTCATAGTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1394s1c1
Sequence:CCGGCCTCAATTACATCCGCAGCTTCTCGAGAAGCTGCGGATGTAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-659s1c1
Sequence:CCGGGCGGGTTATCAACGCCATCAACTCGAGTTGATGGCGTTGATAACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1082s1c1
Sequence:CCGGCCTGTATGGTTTCTTCTGGAACTCGAGTTCCAGAAGAAACCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-95s1c1
Sequence:CCGGCCTGCACTTCTTTAAGACCTTCTCGAGAAGGTCTTAAAGAAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010795
VALIDATED
MGAT3 MISSION shRNA shRNA Plasmid DNA
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1502s1c1
Sequence:CCGGGCTCAAGAACTATGACCAGTTCTCGAGAACTGGTCATAGTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1394s1c1
Sequence:CCGGCCTCAATTACATCCGCAGCTTCTCGAGAAGCTGCGGATGTAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-659s1c1
Sequence:CCGGGCGGGTTATCAACGCCATCAACTCGAGTTGATGGCGTTGATAACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1082s1c1
Sequence:CCGGCCTGTATGGTTTCTTCTGGAACTCGAGTTCCAGAAGAAACCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-95s1c1
Sequence:CCGGCCTGCACTTCTTTAAGACCTTCTCGAGAAGGTCTTAAAGAAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010795
VALIDATED
MGAT3 MISSION shRNA Lentiviral Transduction Particles
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1502s1c1
Sequence:CCGGGCTCAAGAACTATGACCAGTTCTCGAGAACTGGTCATAGTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1394s1c1
Sequence:CCGGCCTCAATTACATCCGCAGCTTCTCGAGAAGCTGCGGATGTAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-659s1c1
Sequence:CCGGGCGGGTTATCAACGCCATCAACTCGAGTTGATGGCGTTGATAACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-1082s1c1
Sequence:CCGGCCTGTATGGTTTCTTCTGGAACTCGAGTTCCAGAAGAAACCATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010795.2-95s1c1
Sequence:CCGGCCTGCACTTCTTTAAGACCTTCTCGAGAAGGTCTTAAAGAAGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks