EMAIL THIS PAGE TO A FRIEND

MGST1

microsomal glutathione S-transferase 1

Synonyms: GST12 MGST MGST-I
UniProtKB ID: P10620, A8K533, G5EA53
Gene ID:
Human(4257) Summary: The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Mouse(56615) microsomal glutathione S-transferase 1
Rat(171341) microsomal glutathione S-transferase 1
Zebrafish(449784) microsomal glutathione S-transferase 1
chicken(418178) microsomal glutathione S-transferase 1
dog(477683) microsomal glutathione S-transferase 1
cow(493719) microsomal glutathione S-transferase 1
domestic cat(101099565) microsomal glutathione S-transferase 1
naked mole-rat(101713569) microsomal glutathione S-transferase 1
domestic guinea pig(100736210) microsomal glutathione S-transferase 1
sheep(101103462) microsomal glutathione S-transferase 1
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020300 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080961 MISSION® esiRNA esiRNA human MGST1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020300 Rosetta Predictions human pricing
NM_145764 Rosetta Predictions human pricing
NM_145791 Rosetta Predictions human pricing
NM_145792 Rosetta Predictions human pricing
NM_134349 Rosetta Predictions rat pricing
NM_019946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054702 predicted 690
2 SASI_Hs01_00054703 predicted 354
3 SASI_Hs01_00054704 predicted 460
4 SASI_Hs01_00054705 predicted 698
5 SASI_Hs01_00054706 predicted 403
6 SASI_Hs01_00054707 predicted 500
7 SASI_Hs01_00054709 predicted 265
8 SASI_Hs02_00353217 predicted 393
9 SASI_Hs01_00054711 predicted 690
10 SASI_Hs02_00353218 predicted 462
11 SASI_Hs01_00054708 predicted 697
12 SASI_Hs01_00054710 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197640 predicted 676
2 SASI_Hs01_00197641 predicted 336
3 SASI_Hs01_00197642 predicted 454
4 SASI_Hs01_00197643 predicted 681
5 SASI_Hs01_00197644 predicted 395
6 SASI_Hs01_00197645 predicted 487
7 SASI_Hs01_00197647 predicted 252
8 SASI_Hs02_00365348 predicted 376
9 SASI_Hs01_00197649 predicted 673
10 SASI_Hs02_00365349 predicted 453
11 SASI_Hs01_00197646 predicted 691
12 SASI_Hs01_00197648 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100072 predicted 746
2 SASI_Hs01_00100073 predicted 411
3 SASI_Hs01_00100074 predicted 518
4 SASI_Hs01_00100075 predicted 749
5 SASI_Hs01_00100076 predicted 462
6 SASI_Hs01_00100077 predicted 551
7 SASI_Hs01_00100079 predicted 319
8 SASI_Hs02_00365350 predicted 442
9 SASI_Hs01_00100081 predicted 742
10 SASI_Hs02_00365351 predicted 518
11 SASI_Hs01_00100078 predicted 752
12 SASI_Hs01_00100080 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036886 predicted 669
2 SASI_Hs01_00036887 predicted 332
3 SASI_Hs01_00036888 predicted 439
4 SASI_Hs01_00036889 predicted 670
5 SASI_Hs01_00036890 predicted 387
6 SASI_Hs01_00036891 predicted 476
7 SASI_Hs01_00036893 predicted 239
8 SASI_Hs02_00365352 predicted 366
9 SASI_Hs01_00036895 predicted 670
10 SASI_Hs02_00365353 predicted 442
11 SASI_Hs01_00036892 predicted 673
12 SASI_Hs01_00036894 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037728 predicted 378
2 SASI_Rn01_00037729 predicted 586
3 SASI_Rn01_00037730 predicted 418
4 SASI_Rn01_00037731 predicted 381
5 SASI_Rn02_00267904 predicted 376
6 SASI_Rn01_00037732 predicted 484
7 SASI_Rn02_00267905 predicted 296
8 SASI_Rn01_00037733 predicted 520
9 SASI_Rn01_00037734 predicted 207
10 SASI_Rn01_00037735 predicted 475
11 SASI_Rn01_00037736 predicted 286
12 SASI_Rn01_00037737 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064848 predicted 548
2 SASI_Mm01_00064849 predicted 632
3 SASI_Mm01_00064850 predicted 446
4 SASI_Mm01_00064851 predicted 210
5 SASI_Mm01_00064852 predicted 382
6 SASI_Mm01_00064853 predicted 557
7 SASI_Mm01_00064854 predicted 410
8 SASI_Mm01_00064855 predicted 542
9 SASI_Mm01_00064856 predicted 273
10 SASI_Mm01_00064857 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019946
VALIDATED
MGST1 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-410s21c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-512s21c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-203s21c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019946.4-662s21c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-325s21c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-663s1c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-326s1c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019946.3-513s1c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-204s1c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-411s1c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019946
VALIDATED
MGST1 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-410s21c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-512s21c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-203s21c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019946.4-662s21c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-325s21c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-663s1c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-326s1c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019946.3-513s1c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-204s1c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-411s1c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019946
VALIDATED
MGST1 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-410s21c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-512s21c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-203s21c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019946.4-662s21c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019946.4-325s21c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-663s1c1
Sequence:CCGGGCGTGAAAGGAGCAGAGAAATCTCGAGATTTCTCTGCTCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-326s1c1
Sequence:CCGGCCCACCTGAATGATCTTGAAACTCGAGTTTCAAGATCATTCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019946.3-513s1c1
Sequence:CCGGCTATGGAGTTACTTTGTCAATCTCGAGATTGACAAAGTAACTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-204s1c1
Sequence:CCGGCGCATTCCAGAGGATAACCAACTCGAGTTGGTTATCCTCTGGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019946.3-411s1c1
Sequence:CCGGCCTCATGCACTTCAGAATCTTCTCGAGAAGATTCTGAAGTGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020300
VALIDATED
MGST1 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-180s21c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-694s21c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-564s21c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-278s21c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-347s1c1
Sequence:CCGGCTTGGAATTGGCCTCCTGTATCTCGAGATACAGGAGGCCAATTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-180s1c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-694s1c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-699s1c1
Sequence:CCGGGCCAATATCCTGTATTCTTGTCTCGAGACAAGAATACAGGATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-233s1c1
Sequence:CCGGGACTGTGTAGCATTTGGCAAACTCGAGTTTGCCAAATGCTACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-564s1c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-284s1c1
Sequence:CCGGGATGACAGAGTAGAACGTGTACTCGAGTACACGTTCTACTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-278s1c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020300
VALIDATED
MGST1 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-180s21c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-694s21c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-564s21c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-278s21c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-347s1c1
Sequence:CCGGCTTGGAATTGGCCTCCTGTATCTCGAGATACAGGAGGCCAATTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-180s1c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-694s1c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-699s1c1
Sequence:CCGGGCCAATATCCTGTATTCTTGTCTCGAGACAAGAATACAGGATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-233s1c1
Sequence:CCGGGACTGTGTAGCATTTGGCAAACTCGAGTTTGCCAAATGCTACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-564s1c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-284s1c1
Sequence:CCGGGATGACAGAGTAGAACGTGTACTCGAGTACACGTTCTACTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-278s1c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020300
VALIDATED
MGST1 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-180s21c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-694s21c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020300.3-564s21c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020300.3-278s21c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-347s1c1
Sequence:CCGGCTTGGAATTGGCCTCCTGTATCTCGAGATACAGGAGGCCAATTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-180s1c1
Sequence:CCGGGTACTGCAACTGCATTCTATACTCGAGTATAGAATGCAGTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-694s1c1
Sequence:CCGGGCATTGCCAATATCCTGTATTCTCGAGAATACAGGATATTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-699s1c1
Sequence:CCGGGCCAATATCCTGTATTCTTGTCTCGAGACAAGAATACAGGATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-233s1c1
Sequence:CCGGGACTGTGTAGCATTTGGCAAACTCGAGTTTGCCAAATGCTACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-564s1c1
Sequence:CCGGCATACAACTCAGCATCCAGTTCTCGAGAACTGGATGCTGAGTTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020300.3-284s1c1
Sequence:CCGGGATGACAGAGTAGAACGTGTACTCGAGTACACGTTCTACTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020300.3-278s1c1
Sequence:CCGGCGAACAGATGACAGAGTAGAACTCGAGTTCTACTCTGTCATCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks