EMAIL THIS PAGE TO A FRIEND

MIA2

melanoma inhibitory activity 2

UniProtKB ID: Q96PC5, A1L4H0, Q9H6C1
Gene ID:
Mouse(338320) melanoma inhibitory activity 2
Rat(362743) melanoma inhibitory activity 2
Zebrafish(100150328) melanoma inhibitory activity 2
domestic cat(101083520) melanoma inhibitory activity 2
dog(480297) melanoma inhibitory activity 2
chicken(423339) melanoma inhibitory activity 2
domestic guinea pig(100716737) melanoma inhibitory activity 2
sheep(101106549) melanoma inhibitory activity 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132421 MISSION® esiRNA esiRNA human MIA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054024 Rosetta Predictions human pricing
XM_343068 Rosetta Predictions rat pricing
NM_177321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184096 predicted 688
2 SASI_Hs01_00184097 predicted 445
3 SASI_Hs02_00361955 predicted 1767
4 SASI_Hs01_00184098 predicted 207
5 SASI_Hs01_00184099 predicted 292
6 SASI_Hs01_00184100 predicted 1621
7 SASI_Hs02_00361956 predicted 1694
8 SASI_Hs01_00184102 predicted 1036
9 SASI_Hs01_00184103 predicted 1535
10 SASI_Hs02_00361957 predicted 1916
11 SASI_Hs01_00184101 predicted 1511
12 SASI_Hs01_00184104 predicted 560
13 SASI_Hs01_00184105 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145758 predicted 1729
2 SASI_Rn01_00145759 predicted 1661
3 SASI_Rn01_00145760 predicted 1513
4 SASI_Rn01_00145761 predicted 1028
5 SASI_Rn01_00145762 predicted 1000
6 SASI_Rn01_00145763 predicted 1292
7 SASI_Rn01_00145764 predicted 1197
8 SASI_Rn01_00145765 predicted 1487
9 SASI_Rn01_00145766 predicted 1617
10 SASI_Rn01_00145767 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347414 predicted 613
2 SASI_Mm01_00036757 predicted 311
3 SASI_Mm01_00036758 predicted 928
4 SASI_Mm01_00036760 predicted 917
5 SASI_Mm01_00036761 predicted 290
6 SASI_Mm02_00347415 predicted 1169
7 SASI_Mm01_00036762 predicted 716
8 SASI_Mm01_00036764 predicted 274
9 SASI_Mm01_00036765 predicted 870
10 SASI_Mm01_00036766 predicted 1352
11 SASI_Mm01_00036759 predicted 508
12 SASI_Mm01_00036763 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177321
MIA2 MISSION shRNA Bacterial Glycerol Stock
melanoma inhibitory activity 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-877s21c1
Sequence:CCGGGAATCTGAGACGGAGAGTATCCTCGAGGATACTCTCCGTCTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-379s21c1
Sequence:CCGGAGTGAACAGAGTGAATTAAACCTCGAGGTTTAATTCACTCTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1216s21c1
Sequence:CCGGGATAACCTCAAACATCCTATACTCGAGTATAGGATGTTTGAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-996s21c1
Sequence:CCGGCAATCCACCATTACAAGATATCTCGAGATATCTTGTAATGGTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1136s21c1
Sequence:CCGGGATTTGGTATGCTAGGCTTTACTCGAGTAAAGCCTAGCATACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-926s21c1
Sequence:CCGGGTGAGGGCCTTACAAGTTATTCTCGAGAATAACTTGTAAGGCCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-1402s1c1
Sequence:CCGGGAGGACACAGAATTACCATTTCTCGAGAAATGGTAATTCTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-316s1c1
Sequence:CCGGGAAGTCGAAATGCCAACTAAACTCGAGTTTAGTTGGCATTTCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-412s1c1
Sequence:CCGGGAAGAACATATGTACCCATATCTCGAGATATGGGTACATATGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-185s1c1
Sequence:CCGGCGGGAGAAGAGATATCTGTTTCTCGAGAAACAGATATCTCTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177321
MIA2 MISSION shRNA shRNA Plasmid DNA
melanoma inhibitory activity 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-877s21c1
Sequence:CCGGGAATCTGAGACGGAGAGTATCCTCGAGGATACTCTCCGTCTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-379s21c1
Sequence:CCGGAGTGAACAGAGTGAATTAAACCTCGAGGTTTAATTCACTCTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1216s21c1
Sequence:CCGGGATAACCTCAAACATCCTATACTCGAGTATAGGATGTTTGAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-996s21c1
Sequence:CCGGCAATCCACCATTACAAGATATCTCGAGATATCTTGTAATGGTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1136s21c1
Sequence:CCGGGATTTGGTATGCTAGGCTTTACTCGAGTAAAGCCTAGCATACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-926s21c1
Sequence:CCGGGTGAGGGCCTTACAAGTTATTCTCGAGAATAACTTGTAAGGCCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-1402s1c1
Sequence:CCGGGAGGACACAGAATTACCATTTCTCGAGAAATGGTAATTCTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-316s1c1
Sequence:CCGGGAAGTCGAAATGCCAACTAAACTCGAGTTTAGTTGGCATTTCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-412s1c1
Sequence:CCGGGAAGAACATATGTACCCATATCTCGAGATATGGGTACATATGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-185s1c1
Sequence:CCGGCGGGAGAAGAGATATCTGTTTCTCGAGAAACAGATATCTCTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177321
MIA2 MISSION shRNA Lentiviral Transduction Particles
melanoma inhibitory activity 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-877s21c1
Sequence:CCGGGAATCTGAGACGGAGAGTATCCTCGAGGATACTCTCCGTCTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-379s21c1
Sequence:CCGGAGTGAACAGAGTGAATTAAACCTCGAGGTTTAATTCACTCTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1216s21c1
Sequence:CCGGGATAACCTCAAACATCCTATACTCGAGTATAGGATGTTTGAGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-996s21c1
Sequence:CCGGCAATCCACCATTACAAGATATCTCGAGATATCTTGTAATGGTGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-1136s21c1
Sequence:CCGGGATTTGGTATGCTAGGCTTTACTCGAGTAAAGCCTAGCATACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177321.2-926s21c1
Sequence:CCGGGTGAGGGCCTTACAAGTTATTCTCGAGAATAACTTGTAAGGCCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-1402s1c1
Sequence:CCGGGAGGACACAGAATTACCATTTCTCGAGAAATGGTAATTCTGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-316s1c1
Sequence:CCGGGAAGTCGAAATGCCAACTAAACTCGAGTTTAGTTGGCATTTCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-412s1c1
Sequence:CCGGGAAGAACATATGTACCCATATCTCGAGATATGGGTACATATGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177321.2-185s1c1
Sequence:CCGGCGGGAGAAGAGATATCTGTTTCTCGAGAAACAGATATCTCTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks