EMAIL THIS PAGE TO A FRIEND

MICAL1

microtubule associated monooxygenase, calponin and LIM domain containing 1

Synonyms: MICAL MICAL-1 NICAL
Gene ID:
Mouse(171580) microtubule associated monooxygenase, calponin and LIM domain containing 1
Rat(294520) microtubule associated monooxygenase, calponin and LIM domain containing 1
Zebrafish(568573) microtubule associated monooxygenase, calponin and LIM domain containing 1
dog(481958) microtubule associated monoxygenase, calponin and LIM domain containing 1
domestic cat(101100722) microtubule associated monoxygenase, calponin and LIM domain containing 1
cow(508306) microtubule associated monoxygenase, calponin and LIM domain containing 1
Horse(100066627) microtubule associated monoxygenase, calponin and LIM domain containing 1
chicken(429474) microtubule associated monoxygenase, calponin and LIM domain containing 1
sheep(101113940) microtubule associated monoxygenase, calponin and LIM domain containing 1
naked mole-rat(101701740) microtubule associated monooxygenase, calponin and LIM domain containing 1
domestic guinea pig(100715118) microtubule associated monooxygenase, calponin and LIM domain containing 1
Gene Class: Cytoskeleton
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022765 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022765 Rosetta Predictions human pricing
NM_001106397 Rosetta Predictions rat pricing
NM_138315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156851 predicted 931
2 SASI_Hs01_00156852 predicted 2434
3 SASI_Hs01_00156853 predicted 965
4 SASI_Hs01_00156854 predicted 2020
5 SASI_Hs01_00156855 predicted 1096
6 SASI_Hs01_00156856 predicted 3100
7 SASI_Hs01_00156857 predicted 2893
8 SASI_Hs01_00156858 predicted 2271
9 SASI_Hs01_00156859 predicted 3417
10 SASI_Hs02_00356039 predicted 465
11 SASI_Hs01_00156860 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218558 predicted 594
2 SASI_Rn02_00218559 predicted 1528
3 SASI_Rn02_00218560 predicted 1973
4 SASI_Rn02_00218561 predicted 675
5 SASI_Rn02_00218562 predicted 1562
6 SASI_Rn02_00218563 predicted 1341
7 SASI_Rn02_00218564 predicted 1678
8 SASI_Rn02_00218565 predicted 1593
9 SASI_Rn02_00218566 predicted 1601
10 SASI_Rn02_00218567 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173276 predicted 1053
2 SASI_Mm01_00173277 predicted 1065
3 SASI_Mm01_00173279 predicted 560
4 SASI_Mm01_00173280 predicted 1528
5 SASI_Mm01_00173281 predicted 1296
6 SASI_Mm01_00173282 predicted 284
7 SASI_Mm01_00173283 predicted 1939
8 SASI_Mm01_00173284 predicted 2306
9 SASI_Mm01_00173285 predicted 569
10 SASI_Mm02_00339615 predicted 347
11 SASI_Mm01_00173278 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022765
MICAL1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3009s1c1
Sequence:CCGGCTCAGGCACCATGAATAACTACTCGAGTAGTTATTCATGGTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2962s1c1
Sequence:CCGGCCTTTGGACTCAGATGTGGAACTCGAGTTCCACATCTGAGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-798s1c1
Sequence:CCGGGCTTCTGCTGAAGGTAGCATTCTCGAGAATGCTACCTTCAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3350s1c1
Sequence:CCGGGCTACATGAACCGGGAAGAAACTCGAGTTTCTTCCCGGTTCATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-1401s1c1
Sequence:CCGGCTTTGACTTCACGAGCATGATCTCGAGATCATGCTCGTGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-1191s1c1
Sequence:CCGGCTTTGTGATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-985s1c1
Sequence:CCGGGAAGGCTTCAAAGTTCGAGAACTCGAGTTCTCGAACTTTGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2751s1c1
Sequence:CCGGCCAGCGGTTGTCCTCCCTTAACTCGAGTTAAGGGAGGACAACCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022765.2-3534s1c1
Sequence:CCGGGCTTTCGTTCCCACAAAGAAACTCGAGTTTCTTTGTGGGAACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022765
MICAL1 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3009s1c1
Sequence:CCGGCTCAGGCACCATGAATAACTACTCGAGTAGTTATTCATGGTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2962s1c1
Sequence:CCGGCCTTTGGACTCAGATGTGGAACTCGAGTTCCACATCTGAGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-798s1c1
Sequence:CCGGGCTTCTGCTGAAGGTAGCATTCTCGAGAATGCTACCTTCAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3350s1c1
Sequence:CCGGGCTACATGAACCGGGAAGAAACTCGAGTTTCTTCCCGGTTCATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-1401s1c1
Sequence:CCGGCTTTGACTTCACGAGCATGATCTCGAGATCATGCTCGTGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-1191s1c1
Sequence:CCGGCTTTGTGATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-985s1c1
Sequence:CCGGGAAGGCTTCAAAGTTCGAGAACTCGAGTTCTCGAACTTTGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2751s1c1
Sequence:CCGGCCAGCGGTTGTCCTCCCTTAACTCGAGTTAAGGGAGGACAACCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022765.2-3534s1c1
Sequence:CCGGGCTTTCGTTCCCACAAAGAAACTCGAGTTTCTTTGTGGGAACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022765
MICAL1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3009s1c1
Sequence:CCGGCTCAGGCACCATGAATAACTACTCGAGTAGTTATTCATGGTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2962s1c1
Sequence:CCGGCCTTTGGACTCAGATGTGGAACTCGAGTTCCACATCTGAGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-798s1c1
Sequence:CCGGGCTTCTGCTGAAGGTAGCATTCTCGAGAATGCTACCTTCAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-3350s1c1
Sequence:CCGGGCTACATGAACCGGGAAGAAACTCGAGTTTCTTCCCGGTTCATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-1401s1c1
Sequence:CCGGCTTTGACTTCACGAGCATGATCTCGAGATCATGCTCGTGAAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022765.2-1191s1c1
Sequence:CCGGCTTTGTGATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-985s1c1
Sequence:CCGGGAAGGCTTCAAAGTTCGAGAACTCGAGTTCTCGAACTTTGAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022765.2-2751s1c1
Sequence:CCGGCCAGCGGTTGTCCTCCCTTAACTCGAGTTAAGGGAGGACAACCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022765.2-3534s1c1
Sequence:CCGGGCTTTCGTTCCCACAAAGAAACTCGAGTTTCTTTGTGGGAACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138315
VALIDATED
MICAL1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated monooxygenase, calponin and LIM domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1311s1c1
Sequence:CCGGCTTCGACTTCACAAGCATGATCTCGAGATCATGCTTGTGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138315.1-1050s1c1
Sequence:CCGGCACAGGTATTGATCTGGAGAACTCGAGTTCTCCAGATCAATACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-933s1c1
Sequence:CCGGCATTGGCATCACAGCCAACTTCTCGAGAAGTTGGCTGTGATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-567s1c1
Sequence:CCGGGCGTATCAAGTTCTCTAGGCACTCGAGTGCCTAGAGAACTTGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-2977s1c1
Sequence:CCGGCAGCGAAGACTGAACGAGATTCTCGAGAATCTCGTTCAGTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-2743s1c1
Sequence:CCGGCAAGCACCACAAGTTCCTGAACTCGAGTTCAGGAACTTGTGGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1564s1c1
Sequence:CCGGCCCGAGAATATGCATCGAAATCTCGAGATTTCGATGCATATTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138315
VALIDATED
MICAL1 MISSION shRNA shRNA Plasmid DNA
microtubule associated monooxygenase, calponin and LIM domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1311s1c1
Sequence:CCGGCTTCGACTTCACAAGCATGATCTCGAGATCATGCTTGTGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138315.1-1050s1c1
Sequence:CCGGCACAGGTATTGATCTGGAGAACTCGAGTTCTCCAGATCAATACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-933s1c1
Sequence:CCGGCATTGGCATCACAGCCAACTTCTCGAGAAGTTGGCTGTGATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-567s1c1
Sequence:CCGGGCGTATCAAGTTCTCTAGGCACTCGAGTGCCTAGAGAACTTGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-2977s1c1
Sequence:CCGGCAGCGAAGACTGAACGAGATTCTCGAGAATCTCGTTCAGTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-2743s1c1
Sequence:CCGGCAAGCACCACAAGTTCCTGAACTCGAGTTCAGGAACTTGTGGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1564s1c1
Sequence:CCGGCCCGAGAATATGCATCGAAATCTCGAGATTTCGATGCATATTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138315
VALIDATED
MICAL1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated monooxygenase, calponin and LIM domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1311s1c1
Sequence:CCGGCTTCGACTTCACAAGCATGATCTCGAGATCATGCTTGTGAAGTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138315.1-1050s1c1
Sequence:CCGGCACAGGTATTGATCTGGAGAACTCGAGTTCTCCAGATCAATACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-933s1c1
Sequence:CCGGCATTGGCATCACAGCCAACTTCTCGAGAAGTTGGCTGTGATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-567s1c1
Sequence:CCGGGCGTATCAAGTTCTCTAGGCACTCGAGTGCCTAGAGAACTTGATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-2977s1c1
Sequence:CCGGCAGCGAAGACTGAACGAGATTCTCGAGAATCTCGTTCAGTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138315.1-2743s1c1
Sequence:CCGGCAAGCACCACAAGTTCCTGAACTCGAGTTCAGGAACTTGTGGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138315.1-1564s1c1
Sequence:CCGGCCCGAGAATATGCATCGAAATCTCGAGATTTCGATGCATATTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks