EMAIL THIS PAGE TO A FRIEND

MICU1

mitochondrial calcium uptake 1

Synonyms: CALC CBARA1 EFHA3
Gene ID:
Human(10367) Summary: This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Mouse(216001) mitochondrial calcium uptake 1
Rat(365567) mitochondrial calcium uptake 1
Zebrafish(561210) mitochondrial calcium uptake 1
dog(479241) mitochondrial calcium uptake 1
cow(507899) mitochondrial calcium uptake 1
domestic cat(101082596) mitochondrial calcium uptake 1
chicken(769141) mitochondrial calcium uptake 1
sheep(101115094) mitochondrial calcium uptake 1
domestic guinea pig(100715334) mitochondrial calcium uptake 1
naked mole-rat(101699193) mitochondrial calcium uptake 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006077 Rosetta Predictions human pricing
NM_199412 Rosetta Predictions rat pricing
NM_144822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070243 predicted 913
2 SASI_Hs01_00070244 predicted 1230
3 SASI_Hs01_00070245 predicted 1338
4 SASI_Hs01_00070246 predicted 923
5 SASI_Hs01_00070247 predicted 1287
6 SASI_Hs01_00070248 predicted 1065
7 SASI_Hs01_00070249 predicted 764
8 SASI_Hs01_00070250 predicted 1411
9 SASI_Hs02_00340850 predicted 222
10 SASI_Hs01_00070251 predicted 1488
11 SASI_Hs01_00070252 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094666 predicted 510
2 SASI_Rn01_00094667 predicted 644
3 SASI_Rn01_00094668 predicted 813
4 SASI_Rn01_00094669 predicted 1433
5 SASI_Rn01_00094670 predicted 1356
6 SASI_Rn01_00094671 predicted 763
7 SASI_Rn01_00094672 predicted 731
8 SASI_Rn01_00094673 predicted 829
9 SASI_Rn01_00094674 predicted 957
10 SASI_Rn02_00270243 predicted 1050
11 SASI_Rn01_00094675 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151791 predicted 504
2 SASI_Mm01_00151792 predicted 506
3 SASI_Mm01_00151793 predicted 946
4 SASI_Mm01_00151794 predicted 524
5 SASI_Mm02_00340197 predicted 1075
6 SASI_Mm01_00151795 predicted 225
7 SASI_Mm01_00151796 predicted 975
8 SASI_Mm01_00151797 predicted 244
9 SASI_Mm01_00151799 predicted 867
10 SASI_Mm01_00151800 predicted 691
11 SASI_Mm01_00151798 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144822
MICU1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144822.2-1822s21c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-961s21c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-866s21c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-368s21c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144822.1-1822s1c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-866s1c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-368s1c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-961s1c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-135s1c1
Sequence:CCGGACAGACCAAACGAAGATTGATCTCGAGATCAATCTTCGTTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144822
MICU1 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144822.2-1822s21c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-961s21c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-866s21c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-368s21c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144822.1-1822s1c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-866s1c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-368s1c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-961s1c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-135s1c1
Sequence:CCGGACAGACCAAACGAAGATTGATCTCGAGATCAATCTTCGTTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144822
MICU1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144822.2-1822s21c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-961s21c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-866s21c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144822.2-368s21c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144822.1-1822s1c1
Sequence:CCGGGCTGTGGATTTATAGTAGCAACTCGAGTTGCTACTATAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-866s1c1
Sequence:CCGGCCCTCAAGTCTGGCTTATGTTCTCGAGAACATAAGCCAGACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-368s1c1
Sequence:CCGGGCTCTGGATTCAGAGACAGAACTCGAGTTCTGTCTCTGAATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-961s1c1
Sequence:CCGGCGCAAACTTCAGCATGACGTTCTCGAGAACGTCATGCTGAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144822.1-135s1c1
Sequence:CCGGACAGACCAAACGAAGATTGATCTCGAGATCAATCTTCGTTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006077
VALIDATED
MICU1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial calcium uptake 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-340s21c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1180s21c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1410s21c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-593s21c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1490s1c1
Sequence:CCGGCTTCGCTTTACCCAAACAGTACTCGAGTACTGTTTGGGTAAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-281s1c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-1351s1c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1121s1c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-534s1c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006077
VALIDATED
MICU1 MISSION shRNA shRNA Plasmid DNA
mitochondrial calcium uptake 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-340s21c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1180s21c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1410s21c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-593s21c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1490s1c1
Sequence:CCGGCTTCGCTTTACCCAAACAGTACTCGAGTACTGTTTGGGTAAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-281s1c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-1351s1c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1121s1c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-534s1c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006077
VALIDATED
MICU1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial calcium uptake 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-340s21c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1180s21c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-1410s21c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006077.2-593s21c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1490s1c1
Sequence:CCGGCTTCGCTTTACCCAAACAGTACTCGAGTACTGTTTGGGTAAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-281s1c1
Sequence:CCGGCATCGGTGATAAAGGGAAGAACTCGAGTTCTTCCCTTTATCACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-1351s1c1
Sequence:CCGGGCAATGGCGAACTGAGCAATACTCGAGTATTGCTCAGTTCGCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006077.1-1121s1c1
Sequence:CCGGGCAGCTCAAGAAGCACTTCAACTCGAGTTGAAGTGCTTCTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006077.1-534s1c1
Sequence:CCGGCGATCCATAACACCCAATGAACTCGAGTTCATTGGGTGTTATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks