EMAIL THIS PAGE TO A FRIEND

MID1IP1

MID1 interacting protein 1

Synonyms: G12-like MIG12 S14R STRAIT11499 THRSPL
UniProtKB ID: Q9NPA3, D3DWB2
Gene ID:
Mouse(68041) Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish))
Rat(404280) MID1 interacting protein 1
sheep(101102702) MID1 interacting protein 1
domestic guinea pig(100718858) MID1 interacting protein 1
chicken(404752) MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish))
cow(615572) MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish))
domestic cat(101088467) MID1 interacting protein 1
dog(491830) MID1 interacting protein 1
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098790 Rosetta Predictions human pricing
NM_001098791 Rosetta Predictions human pricing
NM_021242 Rosetta Predictions human pricing
NM_206950 Rosetta Predictions rat pricing
NM_026524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319839 predicted 424
2 SASI_Hs02_00319840 predicted 490
3 SASI_Hs02_00319841 predicted 447
4 SASI_Hs02_00319842 predicted 475
5 SASI_Hs02_00319843 predicted 457
6 SASI_Hs02_00319844 predicted 677
7 SASI_Hs02_00319845 predicted 476
8 SASI_Hs02_00319846 predicted 700
9 SASI_Hs02_00319847 predicted 461
10 SASI_Hs02_00319848 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319849 predicted 318
2 SASI_Hs02_00319850 predicted 382
3 SASI_Hs02_00319851 predicted 339
4 SASI_Hs02_00319852 predicted 377
5 SASI_Hs02_00319853 predicted 352
6 SASI_Hs02_00319854 predicted 576
7 SASI_Hs02_00319855 predicted 368
8 SASI_Hs02_00319856 predicted 590
9 SASI_Hs02_00319857 predicted 357
10 SASI_Hs02_00319858 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154271 predicted 857
2 SASI_Hs01_00154273 predicted 927
3 SASI_Hs01_00154274 predicted 876
4 SASI_Hs01_00154275 predicted 914
5 SASI_Hs01_00154276 predicted 891
6 SASI_Hs01_00154277 predicted 1113
7 SASI_Hs01_00154278 predicted 907
8 SASI_Hs01_00154279 predicted 1125
9 SASI_Hs01_00154280 predicted 896
10 SASI_Hs02_00354893 predicted 988
11 SASI_Hs01_00154272 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080269 predicted 1293
2 SASI_Rn01_00080271 predicted 1476
3 SASI_Rn01_00080272 predicted 1094
4 SASI_Rn01_00080273 predicted 541
5 SASI_Rn01_00080274 predicted 498
6 SASI_Rn01_00080275 predicted 928
7 SASI_Rn01_00080276 predicted 907
8 SASI_Rn02_00270396 predicted 458
9 SASI_Rn02_00270397 predicted 522
10 SASI_Rn02_00270398 predicted 1457
11 SASI_Rn01_00080270 predicted 1205
12 SASI_Rn01_00080277 predicted 491
13 SASI_Rn01_00080278 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103184 predicted 1108
2 SASI_Mm01_00103185 predicted 558
3 SASI_Mm01_00103186 predicted 527
4 SASI_Mm01_00103187 predicted 1321
5 SASI_Mm01_00103189 predicted 512
6 SASI_Mm01_00103191 predicted 1246
7 SASI_Mm01_00103192 predicted 492
8 SASI_Mm01_00103193 predicted 1034
9 SASI_Mm02_00330437 predicted 1456
10 SASI_Mm02_00330438 predicted 513
11 SASI_Mm01_00103188 predicted 840
12 SASI_Mm01_00103190 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021242
VALIDATED
MID1IP1 MISSION shRNA Bacterial Glycerol Stock
MID1 interacting protein 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-886s21c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021242.4-994s21c1
Sequence:CCGGCCCGGGTTAGACAACGATGTTCTCGAGAACATCGTTGTCTAACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1646s21c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1351s21c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-886s1c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-2119s1c1
Sequence:CCGGCAGTGTGTATAAGCTGGCATTCTCGAGAATGCCAGCTTATACACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1645s1c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-1353s1c1
Sequence:CCGGCAACATCCTCACTAACAGATACTCGAGTATCTGTTAGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-2219s1c1
Sequence:CCGGCAACTGACATTCTATCGTGTTCTCGAGAACACGATAGAATGTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1356s1c1
Sequence:CCGGCATCCTCACTAACAGATACAACTCGAGTTGTATCTGTTAGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1359s1c1
Sequence:CCGGCCTCACTAACAGATACAAGCACTCGAGTGCTTGTATCTGTTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-885s1c1
Sequence:CCGGCCAGAAGCACTCGCTCTTTAACTCGAGTTAAAGAGCGAGTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1351s1c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021242.3-1346s1c1
Sequence:CCGGGCAAAGCCAACATCCTCACTACTCGAGTAGTGAGGATGTTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021242.3-2118s1c1
Sequence:CCGGCCAGTGTGTATAAGCTGGCATCTCGAGATGCCAGCTTATACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021242
VALIDATED
MID1IP1 MISSION shRNA shRNA Plasmid DNA
MID1 interacting protein 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-886s21c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021242.4-994s21c1
Sequence:CCGGCCCGGGTTAGACAACGATGTTCTCGAGAACATCGTTGTCTAACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1646s21c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1351s21c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-886s1c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-2119s1c1
Sequence:CCGGCAGTGTGTATAAGCTGGCATTCTCGAGAATGCCAGCTTATACACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1645s1c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-1353s1c1
Sequence:CCGGCAACATCCTCACTAACAGATACTCGAGTATCTGTTAGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-2219s1c1
Sequence:CCGGCAACTGACATTCTATCGTGTTCTCGAGAACACGATAGAATGTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1356s1c1
Sequence:CCGGCATCCTCACTAACAGATACAACTCGAGTTGTATCTGTTAGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1359s1c1
Sequence:CCGGCCTCACTAACAGATACAAGCACTCGAGTGCTTGTATCTGTTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-885s1c1
Sequence:CCGGCCAGAAGCACTCGCTCTTTAACTCGAGTTAAAGAGCGAGTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1351s1c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021242.3-1346s1c1
Sequence:CCGGGCAAAGCCAACATCCTCACTACTCGAGTAGTGAGGATGTTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021242.3-2118s1c1
Sequence:CCGGCCAGTGTGTATAAGCTGGCATCTCGAGATGCCAGCTTATACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021242
VALIDATED
MID1IP1 MISSION shRNA Lentiviral Transduction Particles
MID1 interacting protein 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-886s21c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021242.4-994s21c1
Sequence:CCGGCCCGGGTTAGACAACGATGTTCTCGAGAACATCGTTGTCTAACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1646s21c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021242.4-1351s21c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-886s1c1
Sequence:CCGGCAGAAGCACTCGCTCTTTAACCTCGAGGTTAAAGAGCGAGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-2119s1c1
Sequence:CCGGCAGTGTGTATAAGCTGGCATTCTCGAGAATGCCAGCTTATACACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1645s1c1
Sequence:CCGGGCATTCTATGTTGGTGGGAATCTCGAGATTCCCACCAACATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021242.3-1353s1c1
Sequence:CCGGCAACATCCTCACTAACAGATACTCGAGTATCTGTTAGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-2219s1c1
Sequence:CCGGCAACTGACATTCTATCGTGTTCTCGAGAACACGATAGAATGTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021242.3-1356s1c1
Sequence:CCGGCATCCTCACTAACAGATACAACTCGAGTTGTATCTGTTAGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1359s1c1
Sequence:CCGGCCTCACTAACAGATACAAGCACTCGAGTGCTTGTATCTGTTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-885s1c1
Sequence:CCGGCCAGAAGCACTCGCTCTTTAACTCGAGTTAAAGAGCGAGTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021242.3-1351s1c1
Sequence:CCGGGCCAACATCCTCACTAACAGACTCGAGTCTGTTAGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021242.3-1346s1c1
Sequence:CCGGGCAAAGCCAACATCCTCACTACTCGAGTAGTGAGGATGTTGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021242.3-2118s1c1
Sequence:CCGGCCAGTGTGTATAAGCTGGCATCTCGAGATGCCAGCTTATACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026524
MID1IP1 MISSION shRNA Bacterial Glycerol Stock
MID1 interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1524s1c1
Sequence:CCGGCCTGTCTTAAGTCTTTCAGATCTCGAGATCTGAAAGACTTAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-970s1c1
Sequence:CCGGCAATAGATACAAGCAGGAGATCTCGAGATCTCCTGCTTGTATCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-958s1c1
Sequence:CCGGCAACATCCTCACCAATAGATACTCGAGTATCTATTGGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-956s1c1
Sequence:CCGGGCCAACATCCTCACCAATAGACTCGAGTCTATTGGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1760s1c1
Sequence:CCGGCGTTATTATGAGAAAGTGGATCTCGAGATCCACTTTCTCATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026524
MID1IP1 MISSION shRNA shRNA Plasmid DNA
MID1 interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1524s1c1
Sequence:CCGGCCTGTCTTAAGTCTTTCAGATCTCGAGATCTGAAAGACTTAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-970s1c1
Sequence:CCGGCAATAGATACAAGCAGGAGATCTCGAGATCTCCTGCTTGTATCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-958s1c1
Sequence:CCGGCAACATCCTCACCAATAGATACTCGAGTATCTATTGGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-956s1c1
Sequence:CCGGGCCAACATCCTCACCAATAGACTCGAGTCTATTGGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1760s1c1
Sequence:CCGGCGTTATTATGAGAAAGTGGATCTCGAGATCCACTTTCTCATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026524
MID1IP1 MISSION shRNA Lentiviral Transduction Particles
MID1 interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1524s1c1
Sequence:CCGGCCTGTCTTAAGTCTTTCAGATCTCGAGATCTGAAAGACTTAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-970s1c1
Sequence:CCGGCAATAGATACAAGCAGGAGATCTCGAGATCTCCTGCTTGTATCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-958s1c1
Sequence:CCGGCAACATCCTCACCAATAGATACTCGAGTATCTATTGGTGAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026524.2-956s1c1
Sequence:CCGGGCCAACATCCTCACCAATAGACTCGAGTCTATTGGTGAGGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026524.2-1760s1c1
Sequence:CCGGCGTTATTATGAGAAAGTGGATCTCGAGATCCACTTTCTCATAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks