EMAIL THIS PAGE TO A FRIEND

MIER3

mesoderm induction early response 1, family member 3

Gene ID:
Mouse(218613) mesoderm induction early response 1, family member 3
Rat(310086) mesoderm induction early response 1, family member 3
sheep(101111746) mesoderm induction early response 1, family member 3
naked mole-rat(101718792) mesoderm induction early response 1, family member 3
Domestic Rabbit(100328656) mesoderm induction early response 1, family member 3
domestic guinea pig(100723181) mesoderm induction early response 1, family member 3
chicken(427146) mesoderm induction early response 1, family member 3
domestic cat(101097125) mesoderm induction early response 1, family member 3
cow(508556) mesoderm induction early response 1, family member 3
dog(487215) mesoderm induction early response 1, family member 3
288 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152622 Rosetta Predictions human pricing
XM_001074643 Rosetta Predictions rat pricing
XM_226757 Rosetta Predictions rat pricing
NM_172593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031329 predicted 200
2 SASI_Hs02_00366483 predicted 1412
3 SASI_Hs02_00366484 predicted 1409
4 SASI_Hs01_00031330 predicted 724
5 SASI_Hs01_00031331 predicted 1077
6 SASI_Hs01_00031333 predicted 1724
7 SASI_Hs01_00031335 predicted 296
8 SASI_Hs01_00031336 predicted 784
9 SASI_Hs01_00031337 predicted 635
10 SASI_Hs02_00366485 predicted 679
11 SASI_Hs01_00031332 predicted 468
12 SASI_Hs01_00031334 predicted 1209
13 SASI_Hs01_00031338 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346885 predicted 1034
2 SASI_Rn02_00346886 predicted 1688
3 SASI_Rn02_00346887 predicted 447
4 SASI_Rn02_00346888 predicted 278
5 SASI_Rn02_00346889 predicted 1589
6 SASI_Rn02_00346890 predicted 428
7 SASI_Rn02_00346891 predicted 1460
8 SASI_Rn02_00346892 predicted 1731
9 SASI_Rn02_00346893 predicted 974
10 SASI_Rn02_00346894 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383865 predicted 413
2 SASI_Rn02_00383866 predicted 279
3 SASI_Rn02_00383867 predicted 281
4 SASI_Rn02_00383868 predicted 394
5 SASI_Rn02_00383869 predicted 218
6 SASI_Rn02_00383870 predicted 392
7 SASI_Rn02_00383871 predicted 1043
8 SASI_Rn02_00383872 predicted 1682
9 SASI_Rn02_00383873 predicted 447
10 SASI_Rn02_00383874 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344284 predicted 1879
2 SASI_Mm02_00344285 predicted 1155
3 SASI_Mm01_00074670 predicted 1224
4 SASI_Mm01_00074671 predicted 876
5 SASI_Mm02_00344286 predicted 932
6 SASI_Mm01_00074672 predicted 587
7 SASI_Mm02_00344287 predicted 455
8 SASI_Mm01_00074675 predicted 477
9 SASI_Mm01_00074676 predicted 399
10 SASI_Mm02_00344288 predicted 1191
11 SASI_Mm01_00074669 predicted 768
12 SASI_Mm01_00074673 predicted 240
13 SASI_Mm01_00074674 predicted 746
14 SASI_Mm01_00074677 predicted 562
15 SASI_Mm01_00074678 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152622
VALIDATED
MIER3 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, family member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1408s1c1
Sequence:CCGGCTCGGAGCTAAACCCTATGAACTCGAGTTCATAGGGTTTAGCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-2047s1c1
Sequence:CCGGGCACAGATGTTCTGAACTGAACTCGAGTTCAGTTCAGAACATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-3428s1c1
Sequence:CCGGGCTCTGTGTTACTTTCTTGTACTCGAGTACAAGAAAGTAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152622.2-1161s1c1
Sequence:CCGGCTATTCCTGATCAACAGCTAACTCGAGTTAGCTGTTGATCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-519s1c1
Sequence:CCGGGTGGTAATTCACCTGAAGATTCTCGAGAATCTTCAGGTGAATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1609s1c1
Sequence:CCGGCAACGAGACCAATGGTTTCATCTCGAGATGAAACCATTGGTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-1483s1c1
Sequence:CCGGCGTCCCTGAATCCTTTATGAACTCGAGTTCATAAAGGATTCAGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-756s1c1
Sequence:CCGGCAAGGGACAATGAACAGGCATCTCGAGATGCCTGTTCATTGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152622.2-152s1c1
Sequence:CCGGGAAATGATGGATGAGGGTAAACTCGAGTTTACCCTCATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-593s1c1
Sequence:CCGGCTTGGAGAGTACGATGGTAATCTCGAGATTACCATCGTACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152622
VALIDATED
MIER3 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, family member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1408s1c1
Sequence:CCGGCTCGGAGCTAAACCCTATGAACTCGAGTTCATAGGGTTTAGCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-2047s1c1
Sequence:CCGGGCACAGATGTTCTGAACTGAACTCGAGTTCAGTTCAGAACATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-3428s1c1
Sequence:CCGGGCTCTGTGTTACTTTCTTGTACTCGAGTACAAGAAAGTAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152622.2-1161s1c1
Sequence:CCGGCTATTCCTGATCAACAGCTAACTCGAGTTAGCTGTTGATCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-519s1c1
Sequence:CCGGGTGGTAATTCACCTGAAGATTCTCGAGAATCTTCAGGTGAATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1609s1c1
Sequence:CCGGCAACGAGACCAATGGTTTCATCTCGAGATGAAACCATTGGTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-1483s1c1
Sequence:CCGGCGTCCCTGAATCCTTTATGAACTCGAGTTCATAAAGGATTCAGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-756s1c1
Sequence:CCGGCAAGGGACAATGAACAGGCATCTCGAGATGCCTGTTCATTGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152622.2-152s1c1
Sequence:CCGGGAAATGATGGATGAGGGTAAACTCGAGTTTACCCTCATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-593s1c1
Sequence:CCGGCTTGGAGAGTACGATGGTAATCTCGAGATTACCATCGTACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152622
VALIDATED
MIER3 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, family member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1408s1c1
Sequence:CCGGCTCGGAGCTAAACCCTATGAACTCGAGTTCATAGGGTTTAGCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-2047s1c1
Sequence:CCGGGCACAGATGTTCTGAACTGAACTCGAGTTCAGTTCAGAACATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-3428s1c1
Sequence:CCGGGCTCTGTGTTACTTTCTTGTACTCGAGTACAAGAAAGTAACACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152622.2-1161s1c1
Sequence:CCGGCTATTCCTGATCAACAGCTAACTCGAGTTAGCTGTTGATCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-519s1c1
Sequence:CCGGGTGGTAATTCACCTGAAGATTCTCGAGAATCTTCAGGTGAATTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-1609s1c1
Sequence:CCGGCAACGAGACCAATGGTTTCATCTCGAGATGAAACCATTGGTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-1483s1c1
Sequence:CCGGCGTCCCTGAATCCTTTATGAACTCGAGTTCATAAAGGATTCAGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152622.2-756s1c1
Sequence:CCGGCAAGGGACAATGAACAGGCATCTCGAGATGCCTGTTCATTGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152622.2-152s1c1
Sequence:CCGGGAAATGATGGATGAGGGTAAACTCGAGTTTACCCTCATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152622.2-593s1c1
Sequence:CCGGCTTGGAGAGTACGATGGTAATCTCGAGATTACCATCGTACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172593
VALIDATED
MIER3 MISSION shRNA Bacterial Glycerol Stock
mesoderm induction early response 1, family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-367s1c1
Sequence:CCGGCCAAGTGAACTTGCAGACGAACTCGAGTTCGTCTGCAAGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172593.1-658s1c1
Sequence:CCGGCCTTATCTTGGCGAGTACAATCTCGAGATTGTACTCGCCAAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-563s1c1
Sequence:CCGGCCGAGATTGAGGACGTTGAAACTCGAGTTTCAACGTCCTCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-1430s1c1
Sequence:CCGGCCAGCAATGGTGAAAGTGATTCTCGAGAATCACTTTCACCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-2203s1c1
Sequence:CCGGCCCTGTTCAATGTAGCATTATCTCGAGATAATGCTACATTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172593
VALIDATED
MIER3 MISSION shRNA shRNA Plasmid DNA
mesoderm induction early response 1, family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-367s1c1
Sequence:CCGGCCAAGTGAACTTGCAGACGAACTCGAGTTCGTCTGCAAGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172593.1-658s1c1
Sequence:CCGGCCTTATCTTGGCGAGTACAATCTCGAGATTGTACTCGCCAAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-563s1c1
Sequence:CCGGCCGAGATTGAGGACGTTGAAACTCGAGTTTCAACGTCCTCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-1430s1c1
Sequence:CCGGCCAGCAATGGTGAAAGTGATTCTCGAGAATCACTTTCACCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-2203s1c1
Sequence:CCGGCCCTGTTCAATGTAGCATTATCTCGAGATAATGCTACATTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172593
VALIDATED
MIER3 MISSION shRNA Lentiviral Transduction Particles
mesoderm induction early response 1, family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-367s1c1
Sequence:CCGGCCAAGTGAACTTGCAGACGAACTCGAGTTCGTCTGCAAGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172593.1-658s1c1
Sequence:CCGGCCTTATCTTGGCGAGTACAATCTCGAGATTGTACTCGCCAAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-563s1c1
Sequence:CCGGCCGAGATTGAGGACGTTGAAACTCGAGTTTCAACGTCCTCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-1430s1c1
Sequence:CCGGCCAGCAATGGTGAAAGTGATTCTCGAGAATCACTTTCACCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172593.1-2203s1c1
Sequence:CCGGCCCTGTTCAATGTAGCATTATCTCGAGATAATGCTACATTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks