EMAIL THIS PAGE TO A FRIEND

MIF

macrophage migration inhibitory factor (glycosylation-inhibiting factor)

Synonyms: GIF GLIF MMIF
UniProtKB ID: P14174, A5Z1R8, B2R4S3, Q2V4Y5, Q6FHV0
Gene ID:
Human(4282) Summary: This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. [provided by RefSeq, Jul 2008]
Mouse(17319) macrophage migration inhibitory factor
Rat(81683) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Zebrafish(751093) macrophage migration inhibitory factor
cow(280858) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
domestic cat(101090298) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
dog(595146) macrophage migration inhibitory factor
chicken(100857237) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
domestic guinea pig(100719548) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
naked mole-rat(101725992) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
sheep(780466) macrophage migration inhibitory factor (glycosylation-inhibiting factor)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002415 siRNAs that have been validated in the lab human pricing
NM_031051 Rosetta Predictions rat pricing
NM_010798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002415 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087940 validated 307
1 SASI_Hs01_00087938 validated 270
1 SASI_Hs01_00087939 validated 207
2 SASI_Hs01_00087943 predicted 216
3 SASI_Hs01_00087944 predicted 305
4 SASI_Hs01_00087945 predicted 226
5 SASI_Hs01_00087946 predicted 263
6 SASI_Hs01_00087947 predicted 292
7 SASI_Hs01_00087941 predicted 302
8 SASI_Hs02_00333798 predicted 263
9 SASI_Hs01_00087942 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099339 predicted 283
2 SASI_Rn01_00099340 predicted 287
3 SASI_Rn01_00099341 predicted 278
4 SASI_Rn01_00099342 predicted 283
5 SASI_Rn01_00099343 predicted 506
6 SASI_Rn01_00099347 predicted 514
7 SASI_Rn01_00099344 predicted 487
8 SASI_Rn01_00099345 predicted 453
9 SASI_Rn01_00099346 predicted 491
10 SASI_Rn01_00099348 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059557 predicted 327
2 SASI_Mm01_00059553 predicted 275
3 SASI_Mm02_00319369 predicted 512
4 SASI_Mm02_00319370 predicted 503
5 SASI_Mm02_00319371 predicted 506
6 SASI_Mm02_00319372 predicted 515
7 SASI_Mm02_00319373 predicted 473
8 SASI_Mm02_00319374 predicted 471
9 SASI_Mm01_00059554 predicted 290
10 SASI_Mm01_00059555 predicted 262
11 SASI_Mm01_00059556 predicted 282
12 SASI_Mm01_00059558 predicted 208
13 SASI_Mm01_00059559 predicted 298
14 SASI_Mm01_00059560 predicted 206
15 SASI_Mm01_00059561 predicted 303
16 SASI_Mm01_00059562 predicted 85
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002415
VALIDATED
MIF MISSION shRNA Bacterial Glycerol Stock
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-374s1c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-202s1c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-306s1c1
Sequence:CCGGGCGCGCAGAACCGCTCCTACACTCGAGTGTAGGAGCGGTTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-280s1c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-382s1c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-382s21c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-374s21c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-202s21c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-280s21c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002415
VALIDATED
MIF MISSION shRNA shRNA Plasmid DNA
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-374s1c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-202s1c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-306s1c1
Sequence:CCGGGCGCGCAGAACCGCTCCTACACTCGAGTGTAGGAGCGGTTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-280s1c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-382s1c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-382s21c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-374s21c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-202s21c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-280s21c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002415
VALIDATED
MIF MISSION shRNA Lentiviral Transduction Particles
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-374s1c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-202s1c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-306s1c1
Sequence:CCGGGCGCGCAGAACCGCTCCTACACTCGAGTGTAGGAGCGGTTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-280s1c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002415.1-382s1c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-382s21c1
Sequence:CCGGCTACATCAACTATTACGACATCTCGAGATGTCGTAATAGTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-374s21c1
Sequence:CCGGGACAGGGTCTACATCAACTATCTCGAGATAGTTGATGTAGACCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-202s21c1
Sequence:CCGGCCAGTACATCGCGGTGCACGTCTCGAGACGTGCACCGCGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002415.1-280s21c1
Sequence:CCGGCCTGCACAGCATCGGCAAGATCTCGAGATCTTGCCGATGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010798
MIF MISSION shRNA Bacterial Glycerol Stock
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010798.1-449s1c1
Sequence:CCGGGCACCGCTGTTCTTTGAGCCTCTCGAGAGGCTCAAAGAACAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-369s1c1
Sequence:CCGGCATCAACTATTACGACATGAACTCGAGTTCATGTCGTAATAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-302s1c1
Sequence:CCGGGCAACTACAGTAAGCTGCTGTCTCGAGACAGCAGCTTACTGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-360s1c1
Sequence:CCGGCCGGGTCTACATCAACTATTACTCGAGTAATAGTTGATGTAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-294s1c1
Sequence:CCGGCCAGAACCGCAACTACAGTAACTCGAGTTACTGTAGTTGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010798
MIF MISSION shRNA shRNA Plasmid DNA
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010798.1-449s1c1
Sequence:CCGGGCACCGCTGTTCTTTGAGCCTCTCGAGAGGCTCAAAGAACAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-369s1c1
Sequence:CCGGCATCAACTATTACGACATGAACTCGAGTTCATGTCGTAATAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-302s1c1
Sequence:CCGGGCAACTACAGTAAGCTGCTGTCTCGAGACAGCAGCTTACTGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-360s1c1
Sequence:CCGGCCGGGTCTACATCAACTATTACTCGAGTAATAGTTGATGTAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-294s1c1
Sequence:CCGGCCAGAACCGCAACTACAGTAACTCGAGTTACTGTAGTTGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010798
MIF MISSION shRNA Lentiviral Transduction Particles
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010798.1-449s1c1
Sequence:CCGGGCACCGCTGTTCTTTGAGCCTCTCGAGAGGCTCAAAGAACAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-369s1c1
Sequence:CCGGCATCAACTATTACGACATGAACTCGAGTTCATGTCGTAATAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-302s1c1
Sequence:CCGGGCAACTACAGTAAGCTGCTGTCTCGAGACAGCAGCTTACTGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-360s1c1
Sequence:CCGGCCGGGTCTACATCAACTATTACTCGAGTAATAGTTGATGTAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010798.1-294s1c1
Sequence:CCGGCCAGAACCGCAACTACAGTAACTCGAGTTACTGTAGTTGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks