EMAIL THIS PAGE TO A FRIEND

MILR1

mast cell immunoglobulin-like receptor 1

Synonyms: Allergin-1 C17orf60 MCA-32 MCA32
Gene ID:
Mouse(380732) mast cell immunoglobulin like receptor 1
Rat(59105) mast cell immunoglobulin-like receptor 1
chicken(417417) mast cell immunoglobulin-like receptor 1
cow(789682) mast cell immunoglobulin-like receptor 1
domestic cat(101084664) mast cell immunoglobulin-like receptor 1
dog(480473) mast cell immunoglobulin-like receptor 1
sheep(101105672) mast cell immunoglobulin-like receptor 1
domestic guinea pig(101788896) mast cell immunoglobulin-like receptor 1
naked mole-rat(101705291) mast cell immunoglobulin-like receptor 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011671 MISSION® esiRNA esiRNA targeting human C17orf60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085423 Rosetta Predictions human pricing
XM_211305 Rosetta Predictions human pricing
XM_935143 Rosetta Predictions human pricing
NM_021585 Rosetta Predictions rat pricing
NM_001033435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317645 predicted 460
2 SASI_Hs02_00317646 predicted 457
3 SASI_Hs02_00317647 predicted 569
4 SASI_Hs02_00317648 predicted 247
5 SASI_Hs02_00317649 predicted 820
6 SASI_Hs02_00317650 predicted 347
7 SASI_Hs02_00317651 predicted 744
8 SASI_Hs02_00317652 predicted 394
9 SASI_Hs02_00317653 predicted 547
10 SASI_Hs02_00317654 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_211305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262511 predicted 462
2 SASI_Hs01_00262512 predicted 461
3 SASI_Hs01_00262513 predicted 566
4 SASI_Hs01_00262514 predicted 243
5 SASI_Hs01_00262515 predicted 511
6 SASI_Hs01_00262516 predicted 346
7 SASI_Hs01_00262517 predicted 740
8 SASI_Hs01_00262518 predicted 397
9 SASI_Hs01_00262519 predicted 548
10 SASI_Hs01_00262520 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271912 predicted 238
2 SASI_Hs01_00271913 predicted 366
3 SASI_Hs01_00271914 predicted 388
4 SASI_Hs01_00271915 predicted 457
5 SASI_Hs01_00271916 predicted 247
6 SASI_Hs01_00271917 predicted 390
7 SASI_Hs01_00271918 predicted 392
8 SASI_Hs01_00271919 predicted 237
9 SASI_Hs01_00271920 predicted 390
10 SASI_Hs01_00271921 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262616 predicted 869
2 SASI_Rn02_00262617 predicted 622
3 SASI_Rn02_00262618 predicted 282
4 SASI_Rn02_00262619 predicted 312
5 SASI_Rn02_00262620 predicted 349
6 SASI_Rn02_00262621 predicted 423
7 SASI_Rn02_00262622 predicted 675
8 SASI_Rn02_00262623 predicted 469
9 SASI_Rn02_00262624 predicted 497
10 SASI_Rn02_00262625 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148545 predicted 720
2 SASI_Mm01_00148546 predicted 653
3 SASI_Mm01_00148547 predicted 986
4 SASI_Mm01_00148549 predicted 516
5 SASI_Mm01_00148550 predicted 814
6 SASI_Mm01_00148551 predicted 378
7 SASI_Mm01_00148552 predicted 501
8 SASI_Mm01_00148553 predicted 1004
9 SASI_Mm01_00148554 predicted 779
10 SASI_Mm02_00288748 predicted 835
11 SASI_Mm01_00148548 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085423
MILR1 MISSION shRNA Bacterial Glycerol Stock
mast cell immunoglobulin-like receptor 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085423.1-1106s21c1
Sequence:CCGGCATCTCAGGATGGAGTCTCACCTCGAGGTGAGACTCCATCCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-469s21c1
Sequence:CCGGACAGACCGACATATAACATTACTCGAGTAATGTTATATGTCGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-237s21c1
Sequence:CCGGATCACTGCAGATCACCTATTCCTCGAGGAATAGGTGATCTGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-737s21c1
Sequence:CCGGTACTACTTCCAGGGTTATTACCTCGAGGTAATAACCCTGGAAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085423
MILR1 MISSION shRNA shRNA Plasmid DNA
mast cell immunoglobulin-like receptor 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085423.1-1106s21c1
Sequence:CCGGCATCTCAGGATGGAGTCTCACCTCGAGGTGAGACTCCATCCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-469s21c1
Sequence:CCGGACAGACCGACATATAACATTACTCGAGTAATGTTATATGTCGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-237s21c1
Sequence:CCGGATCACTGCAGATCACCTATTCCTCGAGGAATAGGTGATCTGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-737s21c1
Sequence:CCGGTACTACTTCCAGGGTTATTACCTCGAGGTAATAACCCTGGAAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085423
MILR1 MISSION shRNA Lentiviral Transduction Particles
mast cell immunoglobulin-like receptor 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085423.1-1106s21c1
Sequence:CCGGCATCTCAGGATGGAGTCTCACCTCGAGGTGAGACTCCATCCTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-469s21c1
Sequence:CCGGACAGACCGACATATAACATTACTCGAGTAATGTTATATGTCGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-237s21c1
Sequence:CCGGATCACTGCAGATCACCTATTCCTCGAGGAATAGGTGATCTGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085423.1-737s21c1
Sequence:CCGGTACTACTTCCAGGGTTATTACCTCGAGGTAATAACCCTGGAAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033435
VALIDATED
MILR1 MISSION shRNA Bacterial Glycerol Stock
mast cell immunoglobulin-like receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-51s21c1
Sequence:CCGGCCGTTTCATTCAAGGGAATAACTCGAGTTATTCCCTTGAATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-505s21c1
Sequence:CCGGAGTCCTAGTTCTGGCTTATTTCTCGAGAAATAAGCCAGAACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-1023s21c1
Sequence:CCGGCAAGTAGCCAGGCTTGATAAGCTCGAGCTTATCAAGCCTGGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-93s21c1
Sequence:CCGGTACTTTGGGCTCTTACAATTTCTCGAGAAATTGTAAGAGCCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-250s21c1
Sequence:CCGGATCAGTAGACATCACCTATTCCTCGAGGAATAGGTGATGTCTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033435
VALIDATED
MILR1 MISSION shRNA shRNA Plasmid DNA
mast cell immunoglobulin-like receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-51s21c1
Sequence:CCGGCCGTTTCATTCAAGGGAATAACTCGAGTTATTCCCTTGAATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-505s21c1
Sequence:CCGGAGTCCTAGTTCTGGCTTATTTCTCGAGAAATAAGCCAGAACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-1023s21c1
Sequence:CCGGCAAGTAGCCAGGCTTGATAAGCTCGAGCTTATCAAGCCTGGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-93s21c1
Sequence:CCGGTACTTTGGGCTCTTACAATTTCTCGAGAAATTGTAAGAGCCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-250s21c1
Sequence:CCGGATCAGTAGACATCACCTATTCCTCGAGGAATAGGTGATGTCTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033435
VALIDATED
MILR1 MISSION shRNA Lentiviral Transduction Particles
mast cell immunoglobulin-like receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-51s21c1
Sequence:CCGGCCGTTTCATTCAAGGGAATAACTCGAGTTATTCCCTTGAATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-505s21c1
Sequence:CCGGAGTCCTAGTTCTGGCTTATTTCTCGAGAAATAAGCCAGAACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-1023s21c1
Sequence:CCGGCAAGTAGCCAGGCTTGATAAGCTCGAGCTTATCAAGCCTGGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-93s21c1
Sequence:CCGGTACTTTGGGCTCTTACAATTTCTCGAGAAATTGTAAGAGCCCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033435.2-250s21c1
Sequence:CCGGATCAGTAGACATCACCTATTCCTCGAGGAATAGGTGATGTCTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks