EMAIL THIS PAGE TO A FRIEND

MIPOL1

mirror-image polydactyly 1

UniProtKB ID: Q8TD10, D3DSA4, Q7Z3J0, Q8IV14
Gene ID:
Human(145282) Summary: This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Mouse(73490) mirror-image polydactyly gene 1 homolog (human)
Rat(100911970) mirror-image polydactyly 1
Zebrafish(321390) mirror-image polydactyly 1
domestic cat(101085638) mirror-image polydactyly 1
cow(528380) mirror-image polydactyly 1
Horse(100059602) mirror-image polydactyly 1
dog(480294) mirror-image polydactyly 1
chicken(423331) mirror-image polydactyly 1
sheep(101121886) mirror-image polydactyly 1
naked mole-rat(101727709) mirror-image polydactyly 1
domestic guinea pig(100730469) mirror-image polydactyly 1
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001164370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138731 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363835 predicted 1428
2 SASI_Hs01_00235426 predicted 715
3 SASI_Hs02_00363836 predicted 1386
4 SASI_Hs01_00235427 predicted 999
5 SASI_Hs01_00235430 predicted 552
6 SASI_Hs01_00235432 predicted 532
7 SASI_Hs01_00235433 predicted 1477
8 SASI_Hs01_00235434 predicted 1026
9 SASI_Hs01_00235435 predicted 1056
10 SASI_Hs02_00363837 predicted 996
11 SASI_Hs01_00235428 predicted 1250
12 SASI_Hs01_00235429 predicted 771
13 SASI_Hs01_00235431 predicted 1363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138731
MIPOL1 MISSION shRNA Bacterial Glycerol Stock
mirror-image polydactyly 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138731.5-1216s21c1
Sequence:CCGGAGAAGAATGGAGCTATAATTGCTCGAGCAATTATAGCTCCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138731.5-2152s21c1
Sequence:CCGGTAAAGTTGGTTAGGATCATATCTCGAGATATGATCCTAACCAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138731.2-1259s1c1
Sequence:CCGGGCACTAATAGAAGAACGGGATCTCGAGATCCCGTTCTTCTATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138731.2-2302s1c1
Sequence:CCGGGCGTGTATGTAATCTTTGTTACTCGAGTAACAAAGATTACATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1480s1c1
Sequence:CCGGCCTTCGAGTTTACTACAGTTTCTCGAGAAACTGTAGTAAACTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1481s1c1
Sequence:CCGGCTTCGAGTTTACTACAGTTTACTCGAGTAAACTGTAGTAAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-853s1c1
Sequence:CCGGGCTTCAGCAGAAATTGGCTAACTCGAGTTAGCCAATTTCTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-580s1c1
Sequence:CCGGGCATCGGAAATCCACTGAATTCTCGAGAATTCAGTGGATTTCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138731
MIPOL1 MISSION shRNA shRNA Plasmid DNA
mirror-image polydactyly 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138731.5-1216s21c1
Sequence:CCGGAGAAGAATGGAGCTATAATTGCTCGAGCAATTATAGCTCCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138731.5-2152s21c1
Sequence:CCGGTAAAGTTGGTTAGGATCATATCTCGAGATATGATCCTAACCAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138731.2-1259s1c1
Sequence:CCGGGCACTAATAGAAGAACGGGATCTCGAGATCCCGTTCTTCTATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138731.2-2302s1c1
Sequence:CCGGGCGTGTATGTAATCTTTGTTACTCGAGTAACAAAGATTACATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1480s1c1
Sequence:CCGGCCTTCGAGTTTACTACAGTTTCTCGAGAAACTGTAGTAAACTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1481s1c1
Sequence:CCGGCTTCGAGTTTACTACAGTTTACTCGAGTAAACTGTAGTAAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-853s1c1
Sequence:CCGGGCTTCAGCAGAAATTGGCTAACTCGAGTTAGCCAATTTCTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-580s1c1
Sequence:CCGGGCATCGGAAATCCACTGAATTCTCGAGAATTCAGTGGATTTCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138731
MIPOL1 MISSION shRNA Lentiviral Transduction Particles
mirror-image polydactyly 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138731.5-1216s21c1
Sequence:CCGGAGAAGAATGGAGCTATAATTGCTCGAGCAATTATAGCTCCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138731.5-2152s21c1
Sequence:CCGGTAAAGTTGGTTAGGATCATATCTCGAGATATGATCCTAACCAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138731.2-1259s1c1
Sequence:CCGGGCACTAATAGAAGAACGGGATCTCGAGATCCCGTTCTTCTATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138731.2-2302s1c1
Sequence:CCGGGCGTGTATGTAATCTTTGTTACTCGAGTAACAAAGATTACATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1480s1c1
Sequence:CCGGCCTTCGAGTTTACTACAGTTTCTCGAGAAACTGTAGTAAACTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-1481s1c1
Sequence:CCGGCTTCGAGTTTACTACAGTTTACTCGAGTAAACTGTAGTAAACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-853s1c1
Sequence:CCGGGCTTCAGCAGAAATTGGCTAACTCGAGTTAGCCAATTTCTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138731.2-580s1c1
Sequence:CCGGGCATCGGAAATCCACTGAATTCTCGAGAATTCAGTGGATTTCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164370
VALIDATED
MIPOL1 MISSION shRNA Bacterial Glycerol Stock
mirror-image polydactyly 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-825s21c1
Sequence:CCGGGCAGACACTGGGATAGCTATTCTCGAGAATAGCTATCCCAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-629s21c1
Sequence:CCGGTTTGGTTGAAGAAGTGTATTTCTCGAGAAATACACTTCTTCAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-1161s21c1
Sequence:CCGGTACAGCTTGCACAAATCATTACTCGAGTAATGATTTGTGCAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-426s21c1
Sequence:CCGGGTGATTTCTCATCAAGTTATCCTCGAGGATAACTTGATGAGAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-659s21c1
Sequence:CCGGAGAACGTGATGAAGCTATTATCTCGAGATAATAGCTTCATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-1226s21c1
Sequence:CCGGTACCTATGAAGAAGCCTTAAACTCGAGTTTAAGGCTTCTTCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-786s21c1
Sequence:CCGGGACATGACATTACAGGAATTACTCGAGTAATTCCTGTAATGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164370
VALIDATED
MIPOL1 MISSION shRNA shRNA Plasmid DNA
mirror-image polydactyly 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-825s21c1
Sequence:CCGGGCAGACACTGGGATAGCTATTCTCGAGAATAGCTATCCCAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-629s21c1
Sequence:CCGGTTTGGTTGAAGAAGTGTATTTCTCGAGAAATACACTTCTTCAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-1161s21c1
Sequence:CCGGTACAGCTTGCACAAATCATTACTCGAGTAATGATTTGTGCAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-426s21c1
Sequence:CCGGGTGATTTCTCATCAAGTTATCCTCGAGGATAACTTGATGAGAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-659s21c1
Sequence:CCGGAGAACGTGATGAAGCTATTATCTCGAGATAATAGCTTCATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-1226s21c1
Sequence:CCGGTACCTATGAAGAAGCCTTAAACTCGAGTTTAAGGCTTCTTCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-786s21c1
Sequence:CCGGGACATGACATTACAGGAATTACTCGAGTAATTCCTGTAATGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164370
VALIDATED
MIPOL1 MISSION shRNA Lentiviral Transduction Particles
mirror-image polydactyly 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-825s21c1
Sequence:CCGGGCAGACACTGGGATAGCTATTCTCGAGAATAGCTATCCCAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-629s21c1
Sequence:CCGGTTTGGTTGAAGAAGTGTATTTCTCGAGAAATACACTTCTTCAACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-1161s21c1
Sequence:CCGGTACAGCTTGCACAAATCATTACTCGAGTAATGATTTGTGCAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-426s21c1
Sequence:CCGGGTGATTTCTCATCAAGTTATCCTCGAGGATAACTTGATGAGAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-659s21c1
Sequence:CCGGAGAACGTGATGAAGCTATTATCTCGAGATAATAGCTTCATCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164370.1-1226s21c1
Sequence:CCGGTACCTATGAAGAAGCCTTAAACTCGAGTTTAAGGCTTCTTCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164370.1-786s21c1
Sequence:CCGGGACATGACATTACAGGAATTACTCGAGTAATTCCTGTAATGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks