EMAIL THIS PAGE TO A FRIEND

MIR4697HG

MIR4697 host gene (non-protein coding)

Synonyms: LINC00947
Species: Human MIR4697HG(283174)
Gene ID:
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001873 Rosetta Predictions human pricing
XR_017972 Rosetta Predictions human pricing
XR_039979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215307 predicted 1542
2 SASI_Hs01_00215308 predicted 1395
3 SASI_Hs01_00215309 predicted 1611
4 SASI_Hs01_00215310 predicted 1905
5 SASI_Hs01_00215311 predicted 1428
6 SASI_Hs01_00215312 predicted 1447
7 SASI_Hs01_00215313 predicted 1396
8 SASI_Hs01_00215314 predicted 1690
9 SASI_Hs01_00215315 predicted 1134
10 SASI_Hs01_00215316 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495127 predicted 650
2 SASI_Hs02_00495128 predicted 3444
3 SASI_Hs02_00495129 predicted 1707
4 SASI_Hs02_00495130 predicted 758
5 SASI_Hs02_00495131 predicted 2591
6 SASI_Hs02_00495132 predicted 1920
7 SASI_Hs02_00495133 predicted 3684
8 SASI_Hs02_00495134 predicted 1748
9 SASI_Hs02_00495135 predicted 2358
10 SASI_Hs02_00495136 predicted 5217
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514821 predicted 278
2 SASI_Hs02_00514822 predicted 3067
3 SASI_Hs02_00514823 predicted 1335
4 SASI_Hs02_00514824 predicted 377
5 SASI_Hs02_00514825 predicted 2221
6 SASI_Hs02_00514826 predicted 1555
7 SASI_Hs02_00514827 predicted 3303
8 SASI_Hs02_00514828 predicted 1376
9 SASI_Hs02_00514829 predicted 1988
10 SASI_Hs02_00514830 predicted 4846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001873
MIR4697HG MISSION shRNA Bacterial Glycerol Stock
MIR4697 host gene (non-protein coding)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1338s1c1
Sequence:CCGGCCTCAAATTAACTGCTGAGAACTCGAGTTCTCAGCAGTTAATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1487s1c1
Sequence:CCGGGCTGAGTGTTTCTTGTAAGATCTCGAGATCTTACAAGAAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-919s1c1
Sequence:CCGGCCAGACCTCACACATATGCAACTCGAGTTGCATATGTGTGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1190s1c1
Sequence:CCGGGAAAGCAGATACCTTCAGCGTCTCGAGACGCTGAAGGTATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001873
MIR4697HG MISSION shRNA shRNA Plasmid DNA
MIR4697 host gene (non-protein coding)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1338s1c1
Sequence:CCGGCCTCAAATTAACTGCTGAGAACTCGAGTTCTCAGCAGTTAATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1487s1c1
Sequence:CCGGGCTGAGTGTTTCTTGTAAGATCTCGAGATCTTACAAGAAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-919s1c1
Sequence:CCGGCCAGACCTCACACATATGCAACTCGAGTTGCATATGTGTGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1190s1c1
Sequence:CCGGGAAAGCAGATACCTTCAGCGTCTCGAGACGCTGAAGGTATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001873
MIR4697HG MISSION shRNA Lentiviral Transduction Particles
MIR4697 host gene (non-protein coding)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1338s1c1
Sequence:CCGGCCTCAAATTAACTGCTGAGAACTCGAGTTCTCAGCAGTTAATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1487s1c1
Sequence:CCGGGCTGAGTGTTTCTTGTAAGATCTCGAGATCTTACAAGAAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-919s1c1
Sequence:CCGGCCAGACCTCACACATATGCAACTCGAGTTGCATATGTGTGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001873.2-1190s1c1
Sequence:CCGGGAAAGCAGATACCTTCAGCGTCTCGAGACGCTGAAGGTATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks