EMAIL THIS PAGE TO A FRIEND

MIRLET7BHG

MIRLET7B host gene (non-protein coding)

Synonyms: RP4-695O20__B.10
Species: Human MIRLET7BHG(400931)
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207477 Rosetta Predictions human pricing
XR_041674 Rosetta Predictions human pricing
XR_041675 Rosetta Predictions human pricing
XR_041676 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166453 predicted 676
2 SASI_Hs01_00166454 predicted 675
3 SASI_Hs01_00166455 predicted 566
4 SASI_Hs01_00166456 predicted 1101
5 SASI_Hs01_00166457 predicted 273
6 SASI_Hs01_00166458 predicted 905
7 SASI_Hs01_00166459 predicted 1011
8 SASI_Hs01_00166460 predicted 1105
9 SASI_Hs01_00166461 predicted 567
10 SASI_Hs01_00166462 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529459 predicted 210
2 SASI_Hs02_00529460 predicted 234
3 SASI_Hs02_00529461 predicted 368
4 SASI_Hs02_00529462 predicted 401
5 SASI_Hs02_00529463 predicted 114
6 SASI_Hs02_00529464 predicted 130
7 SASI_Hs02_00529465 predicted 141
8 SASI_Hs02_00529466 predicted 59
9 SASI_Hs02_00529467 predicted 399
10 SASI_Hs02_00529468 predicted 103
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529469 predicted 669
2 SASI_Hs02_00529470 predicted 1198
3 SASI_Hs02_00529471 predicted 667
4 SASI_Hs02_00529472 predicted 1229
5 SASI_Hs02_00529473 predicted 561
6 SASI_Hs02_00529474 predicted 1101
7 SASI_Hs02_00529475 predicted 820
8 SASI_Hs02_00529476 predicted 901
9 SASI_Hs02_00529477 predicted 1004
10 SASI_Hs02_00529478 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529479 predicted 673
2 SASI_Hs02_00529480 predicted 1195
3 SASI_Hs02_00529481 predicted 674
4 SASI_Hs02_00529482 predicted 565
5 SASI_Hs02_00529483 predicted 1100
6 SASI_Hs02_00529484 predicted 816
7 SASI_Hs02_00529485 predicted 907
8 SASI_Hs02_00529486 predicted 1005
9 SASI_Hs02_00529487 predicted 1107
10 SASI_Hs02_00529488 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207477
MIRLET7BHG MISSION shRNA Bacterial Glycerol Stock
MIRLET7B host gene (non-protein coding)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1782s1c1
Sequence:CCGGGCCTCAGTTTCTCCACTATGACTCGAGTCATAGTGGAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1728s1c1
Sequence:CCGGCGACCAACTTCTGAGAGCAAACTCGAGTTTGCTCTCAGAAGTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1920s1c1
Sequence:CCGGGTAGACCTTTCAAGTCCACTTCTCGAGAAGTGGACTTGAAAGGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207477
MIRLET7BHG MISSION shRNA shRNA Plasmid DNA
MIRLET7B host gene (non-protein coding)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1782s1c1
Sequence:CCGGGCCTCAGTTTCTCCACTATGACTCGAGTCATAGTGGAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1728s1c1
Sequence:CCGGCGACCAACTTCTGAGAGCAAACTCGAGTTTGCTCTCAGAAGTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1920s1c1
Sequence:CCGGGTAGACCTTTCAAGTCCACTTCTCGAGAAGTGGACTTGAAAGGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207477
MIRLET7BHG MISSION shRNA Lentiviral Transduction Particles
MIRLET7B host gene (non-protein coding)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172723    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1782s1c1
Sequence:CCGGGCCTCAGTTTCTCCACTATGACTCGAGTCATAGTGGAGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1728s1c1
Sequence:CCGGCGACCAACTTCTGAGAGCAAACTCGAGTTTGCTCTCAGAAGTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207477.1-1920s1c1
Sequence:CCGGGTAGACCTTTCAAGTCCACTTCTCGAGAAGTGGACTTGAAAGGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks