EMAIL THIS PAGE TO A FRIEND

MKKS

McKusick-Kaufman syndrome

Synonyms: BBS6 HMCS KMS MKS
UniProtKB ID: Q9NPJ1, A8K7B0, D3DW18
Gene ID:
Human(8195) Summary: This gene encodes a protein which shares sequence similarity with other members of the chaperonin family. The encoded protein may have a role in protein folding, processing and assembly. Mutations in this gene have been observed in patients with Bardet-Biedl syndrome type 6 and McKusick-Kaufman syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(59030) McKusick-Kaufman syndrome
Rat(311456) McKusick-Kaufman syndrome
Zebrafish(393134) McKusick-Kaufman syndrome
cow(614288) McKusick-Kaufman syndrome
Horse(100064409) McKusick-Kaufman syndrome
domestic cat(101092927) McKusick-Kaufman syndrome
dog(485771) McKusick-Kaufman syndrome
chicken(416737) McKusick-Kaufman syndrome
domestic guinea pig(100724231) McKusick-Kaufman syndrome
naked mole-rat(101699409) McKusick-Kaufman syndrome
Domestic Rabbit(100339806) McKusick-Kaufman syndrome
sheep(101109032) McKusick-Kaufman syndrome
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018848 Rosetta Predictions human pricing
NM_170784 Rosetta Predictions human pricing
NM_001008353 Rosetta Predictions rat pricing
NM_021527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352309 predicted 1332
2 SASI_Hs02_00352310 predicted 1371
3 SASI_Hs01_00034631 predicted 1503
4 SASI_Hs01_00034632 predicted 1772
5 SASI_Hs01_00034633 predicted 2300
6 SASI_Hs02_00352311 predicted 1652
7 SASI_Hs01_00034634 predicted 1799
8 SASI_Hs01_00034635 predicted 1522
9 SASI_Hs01_00034636 predicted 2125
10 SASI_Hs01_00034638 predicted 1877
11 SASI_Hs01_00034630 predicted 1168
12 SASI_Hs01_00034637 predicted 2140
13 SASI_Hs01_00034639 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367749 predicted 1208
2 SASI_Hs02_00367750 predicted 1239
3 SASI_Hs01_00245343 predicted 1376
4 SASI_Hs01_00245344 predicted 1637
5 SASI_Hs01_00245345 predicted 2175
6 SASI_Hs02_00367751 predicted 1524
7 SASI_Hs01_00245346 predicted 1664
8 SASI_Hs01_00245347 predicted 1396
9 SASI_Hs01_00245348 predicted 2001
10 SASI_Hs01_00245350 predicted 1748
11 SASI_Hs01_00245342 predicted 1036
12 SASI_Hs01_00245349 predicted 2009
13 SASI_Hs01_00245351 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117335 predicted 1169
2 SASI_Rn01_00117336 predicted 2487
3 SASI_Rn01_00117338 predicted 1499
4 SASI_Rn01_00117339 predicted 1788
5 SASI_Rn01_00117340 predicted 2437
6 SASI_Rn02_00199107 predicted 1749
7 SASI_Rn01_00117341 predicted 1008
8 SASI_Rn01_00117342 predicted 2379
9 SASI_Rn02_00199108 predicted 1345
10 SASI_Rn01_00117343 predicted 1234
11 SASI_Rn01_00117337 predicted 1746
12 SASI_Rn01_00117344 predicted 2181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049733 predicted 1200
2 SASI_Mm01_00049734 predicted 2029
3 SASI_Mm01_00049735 predicted 1046
4 SASI_Mm01_00049736 predicted 1216
5 SASI_Mm01_00049737 predicted 1651
6 SASI_Mm01_00049738 predicted 2208
7 SASI_Mm01_00049739 predicted 2416
8 SASI_Mm01_00049740 predicted 1358
9 SASI_Mm01_00049741 predicted 1399
10 SASI_Mm01_00049742 predicted 2057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021527
VALIDATED
MKKS MISSION shRNA Bacterial Glycerol Stock
McKusick-Kaufman syndrome
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2008s21c1
Sequence:CCGGCCAATAGTTTCTACTACTTATCTCGAGATAAGTAGTAGAAACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1613s21c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2281s21c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2710s21c1
Sequence:CCGGCATAAGAGAATGGCATATATACTCGAGTATATATGCCATTCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1199s21c1
Sequence:CCGGCAGTCACCCATCCCGTATTAACTCGAGTTAATACGGGATGGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2512s1c1
Sequence:CCGGGCAAACTAGTTGAGGTGTCTACTCGAGTAGACACCTCAACTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1779s1c1
Sequence:CCGGCCCAATAGTTTCTACTACTTACTCGAGTAAGTAGTAGAAACTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1385s1c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2053s1c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021527.1-1757s1c1
Sequence:CCGGCAACGCCTATTGGTTCTCTAACTCGAGTTAGAGAACCAATAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021527
VALIDATED
MKKS MISSION shRNA shRNA Plasmid DNA
McKusick-Kaufman syndrome
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2008s21c1
Sequence:CCGGCCAATAGTTTCTACTACTTATCTCGAGATAAGTAGTAGAAACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1613s21c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2281s21c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2710s21c1
Sequence:CCGGCATAAGAGAATGGCATATATACTCGAGTATATATGCCATTCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1199s21c1
Sequence:CCGGCAGTCACCCATCCCGTATTAACTCGAGTTAATACGGGATGGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2512s1c1
Sequence:CCGGGCAAACTAGTTGAGGTGTCTACTCGAGTAGACACCTCAACTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1779s1c1
Sequence:CCGGCCCAATAGTTTCTACTACTTACTCGAGTAAGTAGTAGAAACTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1385s1c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2053s1c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021527.1-1757s1c1
Sequence:CCGGCAACGCCTATTGGTTCTCTAACTCGAGTTAGAGAACCAATAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021527
VALIDATED
MKKS MISSION shRNA Lentiviral Transduction Particles
McKusick-Kaufman syndrome
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2008s21c1
Sequence:CCGGCCAATAGTTTCTACTACTTATCTCGAGATAAGTAGTAGAAACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1613s21c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2281s21c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-2710s21c1
Sequence:CCGGCATAAGAGAATGGCATATATACTCGAGTATATATGCCATTCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021527.2-1199s21c1
Sequence:CCGGCAGTCACCCATCCCGTATTAACTCGAGTTAATACGGGATGGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2512s1c1
Sequence:CCGGGCAAACTAGTTGAGGTGTCTACTCGAGTAGACACCTCAACTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1779s1c1
Sequence:CCGGCCCAATAGTTTCTACTACTTACTCGAGTAAGTAGTAGAAACTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-1385s1c1
Sequence:CCGGGCCAAAGAGTTACAGATTCTACTCGAGTAGAATCTGTAACTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021527.1-2053s1c1
Sequence:CCGGGCAGAAGCTATTGTCAGAGATCTCGAGATCTCTGACAATAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021527.1-1757s1c1
Sequence:CCGGCAACGCCTATTGGTTCTCTAACTCGAGTTAGAGAACCAATAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170784
MKKS MISSION shRNA Bacterial Glycerol Stock
McKusick-Kaufman syndrome
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1400s21c1
Sequence:CCGGTATTACCTGGGATACTCATTGCTCGAGCAATGAGTATCCCAGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-2245s21c1
Sequence:CCGGCAGTGTGGCTGTGGATTATACCTCGAGGTATAATCCACAGCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1756s21c1
Sequence:CCGGATTGGATCCCTAGGCTCAATACTCGAGTATTGAGCCTAGGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1433s21c1
Sequence:CCGGTTCAATTAATGAGGCTATTACCTCGAGGTAATAGCCTCATTAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1672s21c1
Sequence:CCGGCTCAATATGCATCGTATTATTCTCGAGAATAATACGATGCATATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1769s1c1
Sequence:CCGGGCTCAATATGTCCTAATAGTTCTCGAGAACTATTAGGACATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1764s1c1
Sequence:CCGGCCTAGGCTCAATATGTCCTAACTCGAGTTAGGACATATTGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1019s1c1
Sequence:CCGGGCTTCAGTGATTGTGGCTTATCTCGAGATAAGCCACAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-998s1c1
Sequence:CCGGCCATACAGAATCATGTGTCAACTCGAGTTGACACATGATTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1020s1c1
Sequence:CCGGCTTCAGTGATTGTGGCTTATTCTCGAGAATAAGCCACAATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170784
MKKS MISSION shRNA shRNA Plasmid DNA
McKusick-Kaufman syndrome
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1400s21c1
Sequence:CCGGTATTACCTGGGATACTCATTGCTCGAGCAATGAGTATCCCAGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-2245s21c1
Sequence:CCGGCAGTGTGGCTGTGGATTATACCTCGAGGTATAATCCACAGCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1756s21c1
Sequence:CCGGATTGGATCCCTAGGCTCAATACTCGAGTATTGAGCCTAGGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1433s21c1
Sequence:CCGGTTCAATTAATGAGGCTATTACCTCGAGGTAATAGCCTCATTAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1672s21c1
Sequence:CCGGCTCAATATGCATCGTATTATTCTCGAGAATAATACGATGCATATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1769s1c1
Sequence:CCGGGCTCAATATGTCCTAATAGTTCTCGAGAACTATTAGGACATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1764s1c1
Sequence:CCGGCCTAGGCTCAATATGTCCTAACTCGAGTTAGGACATATTGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1019s1c1
Sequence:CCGGGCTTCAGTGATTGTGGCTTATCTCGAGATAAGCCACAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-998s1c1
Sequence:CCGGCCATACAGAATCATGTGTCAACTCGAGTTGACACATGATTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1020s1c1
Sequence:CCGGCTTCAGTGATTGTGGCTTATTCTCGAGAATAAGCCACAATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170784
MKKS MISSION shRNA Lentiviral Transduction Particles
McKusick-Kaufman syndrome
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1400s21c1
Sequence:CCGGTATTACCTGGGATACTCATTGCTCGAGCAATGAGTATCCCAGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-2245s21c1
Sequence:CCGGCAGTGTGGCTGTGGATTATACCTCGAGGTATAATCCACAGCCACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1756s21c1
Sequence:CCGGATTGGATCCCTAGGCTCAATACTCGAGTATTGAGCCTAGGGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1433s21c1
Sequence:CCGGTTCAATTAATGAGGCTATTACCTCGAGGTAATAGCCTCATTAATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170784.1-1672s21c1
Sequence:CCGGCTCAATATGCATCGTATTATTCTCGAGAATAATACGATGCATATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1769s1c1
Sequence:CCGGGCTCAATATGTCCTAATAGTTCTCGAGAACTATTAGGACATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1764s1c1
Sequence:CCGGCCTAGGCTCAATATGTCCTAACTCGAGTTAGGACATATTGAGCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1019s1c1
Sequence:CCGGGCTTCAGTGATTGTGGCTTATCTCGAGATAAGCCACAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-998s1c1
Sequence:CCGGCCATACAGAATCATGTGTCAACTCGAGTTGACACATGATTCTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170784.1-1020s1c1
Sequence:CCGGCTTCAGTGATTGTGGCTTATTCTCGAGAATAAGCCACAATCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks