EMAIL THIS PAGE TO A FRIEND

MKNK1

MAP kinase interacting serine/threonine kinase 1

Synonyms: MNK1
Gene ID:
Human(8569) Summary: This gene encodes a Ser/Thr protein kinase that interacts with, and is activated by ERK1 and p38 mitogen-activated protein kinases, and thus may play a role in the response to environmental stress and cytokines. This kinase may also regulate transcription by phosphorylating eIF4E via interaction with the C-terminal region of eIF4G. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Jan 2012]
Mouse(17346) MAP kinase-interacting serine/threonine kinase 1
Rat(500526) MAP kinase-interacting serine/threonine kinase 1
sheep(101104102) MAP kinase interacting serine/threonine kinase 1
domestic guinea pig(100720835) MAP kinase interacting serine/threonine kinase 1
naked mole-rat(101723982) MAP kinase interacting serine/threonine kinase 1
Zebrafish(555974) MAP kinase interacting serine/threonine kinase 1
dog(482509) MAP kinase interacting serine/threonine kinase 1
cow(525647) MAP kinase interacting serine/threonine kinase 1
domestic cat(101082505) MAP kinase interacting serine/threonine kinase 1
chicken(771961) MAP kinase interacting serine/threonine kinase 1
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411983 ANTI-MKNK1 antibody produced in mouse clone 5E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411984 ANTI-MKNK1 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412175 ANTI-MKNK1 antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412176 ANTI-MKNK1 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412177 ANTI-MKNK1 antibody produced in mouse clone 5E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412183 ANTI-MKNK1 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412442 ANTI-MKNK1 antibody produced in mouse clone 3C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412443 ANTI-MKNK1 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412444 ANTI-MKNK1 antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503425 Anti-MKNK1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA071293 Anti-MKNK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
M3946 Anti-MNK1 antibody produced in rabbit ~1.4 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4503422 Anti-MNK1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4503423 Anti-MNK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4503424 Anti-MNK1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB1302561 ANTI-MOUSE MKNK1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504626 Anti-phospho-MNK1 (pThr255) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504714 Anti-phospho-Mnk1 (pThr385) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
WH0008569M3 Monoclonal Anti-MKNK1 antibody produced in mouse clone S52, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404602 Monoclonal Anti-MKNK1 antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003684 Rosetta Predictions human pricing
NM_198973 Rosetta Predictions human pricing
NM_001044267 Rosetta Predictions rat pricing
NM_021461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228422 predicted 411
2 SASI_Hs01_00228423 predicted 378
3 SASI_Hs01_00228424 predicted 422
4 SASI_Hs01_00228425 predicted 1039
5 SASI_Hs01_00228426 predicted 356
6 SASI_Hs01_00228427 predicted 415
7 SASI_Hs01_00228428 predicted 974
8 SASI_Hs01_00228429 predicted 417
9 SASI_Hs01_00228430 predicted 377
10 SASI_Hs01_00228431 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181512 predicted 254
2 SASI_Hs01_00181513 predicted 213
3 SASI_Hs01_00181514 predicted 253
4 SASI_Hs01_00181515 predicted 759
5 SASI_Hs01_00181516 predicted 249
6 SASI_Hs01_00181517 predicted 692
7 SASI_Hs01_00181518 predicted 254
8 SASI_Hs01_00181519 predicted 210
9 SASI_Hs01_00181520 predicted 205
10 SASI_Hs02_00372487 predicted 731
11 SASI_Hs01_00181521 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205344 predicted 1319
2 SASI_Rn02_00205345 predicted 526
3 SASI_Rn02_00205346 predicted 477
4 SASI_Rn02_00205347 predicted 1253
5 SASI_Rn02_00205348 predicted 1285
6 SASI_Rn02_00205349 predicted 346
7 SASI_Rn02_00205350 predicted 664
8 SASI_Rn02_00205351 predicted 847
9 SASI_Rn02_00205352 predicted 308
10 SASI_Rn02_00205353 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119257 predicted 1392
2 SASI_Mm01_00119258 predicted 665
3 SASI_Mm01_00119259 predicted 428
4 SASI_Mm01_00119260 predicted 791
5 SASI_Mm01_00119261 predicted 820
6 SASI_Mm01_00119262 predicted 260
7 SASI_Mm01_00119263 predicted 1019
8 SASI_Mm01_00119264 predicted 1402
9 SASI_Mm01_00119265 predicted 1265
10 SASI_Mm02_00326113 predicted 1186
11 SASI_Mm01_00119266 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021461
MKNK1 MISSION shRNA Bacterial Glycerol Stock
MAP kinase interacting serine/threonine kinase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-618s21c1
Sequence:CCGGTTGACTTCCTGCACACTAAAGCTCGAGCTTTAGTGTGCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1008s21c1
Sequence:CCGGAGGAAGGCAAATACGAGTTTCCTCGAGGAAACTCGTATTTGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-833s21c1
Sequence:CCGGTTTAGGGACGAGGCTACTTTCCTCGAGGAAAGTAGCCTCGTCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021461.4-1644s21c1
Sequence:CCGGTCACTTGTCACTTTGCATAATCTCGAGATTATGCAAAGTGACAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1390s21c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-790s21c1
Sequence:CCGGATGCGGCTCTGCAGAGTATATCTCGAGATATACTCTGCAGAGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-845s1c1
Sequence:CCGGCGAGGCTACTTTCTATGACAACTCGAGTTGTCATAGAAAGTAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-558s1c1
Sequence:CCGGCAGAAGCGGAAGCACTTCAATCTCGAGATTGAAGTGCTTCCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1074s1c1
Sequence:CCGGCTCATCTCTAAGCTCCTGGTTCTCGAGAACCAGGAGCTTAGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1394s1c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-435s1c1
Sequence:CCGGGAGACACTGTATCAGTGTCAACTCGAGTTGACACTGATACAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021461
MKNK1 MISSION shRNA shRNA Plasmid DNA
MAP kinase interacting serine/threonine kinase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-618s21c1
Sequence:CCGGTTGACTTCCTGCACACTAAAGCTCGAGCTTTAGTGTGCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1008s21c1
Sequence:CCGGAGGAAGGCAAATACGAGTTTCCTCGAGGAAACTCGTATTTGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-833s21c1
Sequence:CCGGTTTAGGGACGAGGCTACTTTCCTCGAGGAAAGTAGCCTCGTCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021461.4-1644s21c1
Sequence:CCGGTCACTTGTCACTTTGCATAATCTCGAGATTATGCAAAGTGACAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1390s21c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-790s21c1
Sequence:CCGGATGCGGCTCTGCAGAGTATATCTCGAGATATACTCTGCAGAGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-845s1c1
Sequence:CCGGCGAGGCTACTTTCTATGACAACTCGAGTTGTCATAGAAAGTAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-558s1c1
Sequence:CCGGCAGAAGCGGAAGCACTTCAATCTCGAGATTGAAGTGCTTCCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1074s1c1
Sequence:CCGGCTCATCTCTAAGCTCCTGGTTCTCGAGAACCAGGAGCTTAGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1394s1c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-435s1c1
Sequence:CCGGGAGACACTGTATCAGTGTCAACTCGAGTTGACACTGATACAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021461
MKNK1 MISSION shRNA Lentiviral Transduction Particles
MAP kinase interacting serine/threonine kinase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-618s21c1
Sequence:CCGGTTGACTTCCTGCACACTAAAGCTCGAGCTTTAGTGTGCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1008s21c1
Sequence:CCGGAGGAAGGCAAATACGAGTTTCCTCGAGGAAACTCGTATTTGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-833s21c1
Sequence:CCGGTTTAGGGACGAGGCTACTTTCCTCGAGGAAAGTAGCCTCGTCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021461.4-1644s21c1
Sequence:CCGGTCACTTGTCACTTTGCATAATCTCGAGATTATGCAAAGTGACAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-1390s21c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021461.4-790s21c1
Sequence:CCGGATGCGGCTCTGCAGAGTATATCTCGAGATATACTCTGCAGAGCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-845s1c1
Sequence:CCGGCGAGGCTACTTTCTATGACAACTCGAGTTGTCATAGAAAGTAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-558s1c1
Sequence:CCGGCAGAAGCGGAAGCACTTCAATCTCGAGATTGAAGTGCTTCCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1074s1c1
Sequence:CCGGCTCATCTCTAAGCTCCTGGTTCTCGAGAACCAGGAGCTTAGAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-1394s1c1
Sequence:CCGGCCGAGATGCAAACCCATGTTTCTCGAGAAACATGGGTTTGCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021461.2-435s1c1
Sequence:CCGGGAGACACTGTATCAGTGTCAACTCGAGTTGACACTGATACAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003684
VALIDATED
MKNK1 MISSION shRNA Bacterial Glycerol Stock
MAP kinase interacting serine/threonine kinase 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1224s21c1
Sequence:CCGGGCATCCAGGAAGGCAAGTATGCTCGAGCATACTTGCCTTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003684.4-945s21c1
Sequence:CCGGACTTGGGCAGTGGGATGAAACCTCGAGGTTTCATCCCACTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-420s21c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1645s21c1
Sequence:CCGGTGCTCCAGTCACACCTTATAGCTCGAGCTATAAGGTGTGACTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-272s21c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-192s1c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2170s1c1
Sequence:CCGGCTGAAATGTATCCCTCGTTTACTCGAGTAAACGAGGGATACATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-2338s1c1
Sequence:CCGGCTTGCTCTTCTTTCTAGAATGCTCGAGCATTCTAGAAAGAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-340s1c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-1190s1c1
Sequence:CCGGCATCTCCAGTGAAGCCAAAGACTCGAGTCTTTGGCTTCACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-984s1c1
Sequence:CCGGCAGGCCACATTCTACGACAAGCTCGAGCTTGTCGTAGAATGTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-2212s1c1
Sequence:CCGGGCTGCTAAAGTCAGTAGTATCCTCGAGGATACTACTGACTTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2489s1c1
Sequence:CCGGGCAGTTAGATAGTGCTCTGTGCTCGAGCACAGAGCACTATCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2275s1c1
Sequence:CCGGCCAGCAAAGATGATACCTTAACTCGAGTTAAGGTATCATCTTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-284s1c1
Sequence:CCGGGCCAGGAAAGTTTGAAGATATCTCGAGATATCTTCAAACTTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-1404s1c1
Sequence:CCGGCAGCACGAAGAGAACGAACTACTCGAGTAGTTCGTTCTCTTCGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-455s1c1
Sequence:CCGGGCTGTATCAGTGTCAGGGAAACTCGAGTTTCCCTGACACTGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003684
VALIDATED
MKNK1 MISSION shRNA shRNA Plasmid DNA
MAP kinase interacting serine/threonine kinase 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1224s21c1
Sequence:CCGGGCATCCAGGAAGGCAAGTATGCTCGAGCATACTTGCCTTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003684.4-945s21c1
Sequence:CCGGACTTGGGCAGTGGGATGAAACCTCGAGGTTTCATCCCACTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-420s21c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1645s21c1
Sequence:CCGGTGCTCCAGTCACACCTTATAGCTCGAGCTATAAGGTGTGACTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-272s21c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-192s1c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2170s1c1
Sequence:CCGGCTGAAATGTATCCCTCGTTTACTCGAGTAAACGAGGGATACATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-2338s1c1
Sequence:CCGGCTTGCTCTTCTTTCTAGAATGCTCGAGCATTCTAGAAAGAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-340s1c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-1190s1c1
Sequence:CCGGCATCTCCAGTGAAGCCAAAGACTCGAGTCTTTGGCTTCACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-984s1c1
Sequence:CCGGCAGGCCACATTCTACGACAAGCTCGAGCTTGTCGTAGAATGTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-2212s1c1
Sequence:CCGGGCTGCTAAAGTCAGTAGTATCCTCGAGGATACTACTGACTTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2489s1c1
Sequence:CCGGGCAGTTAGATAGTGCTCTGTGCTCGAGCACAGAGCACTATCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2275s1c1
Sequence:CCGGCCAGCAAAGATGATACCTTAACTCGAGTTAAGGTATCATCTTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-284s1c1
Sequence:CCGGGCCAGGAAAGTTTGAAGATATCTCGAGATATCTTCAAACTTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-1404s1c1
Sequence:CCGGCAGCACGAAGAGAACGAACTACTCGAGTAGTTCGTTCTCTTCGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-455s1c1
Sequence:CCGGGCTGTATCAGTGTCAGGGAAACTCGAGTTTCCCTGACACTGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003684
VALIDATED
MKNK1 MISSION shRNA Lentiviral Transduction Particles
MAP kinase interacting serine/threonine kinase 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1224s21c1
Sequence:CCGGGCATCCAGGAAGGCAAGTATGCTCGAGCATACTTGCCTTCCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003684.4-945s21c1
Sequence:CCGGACTTGGGCAGTGGGATGAAACCTCGAGGTTTCATCCCACTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-420s21c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-1645s21c1
Sequence:CCGGTGCTCCAGTCACACCTTATAGCTCGAGCTATAAGGTGTGACTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003684.4-272s21c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-192s1c1
Sequence:CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGCCCATCTCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2170s1c1
Sequence:CCGGCTGAAATGTATCCCTCGTTTACTCGAGTAAACGAGGGATACATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-2338s1c1
Sequence:CCGGCTTGCTCTTCTTTCTAGAATGCTCGAGCATTCTAGAAAGAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-340s1c1
Sequence:CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGAACTTTGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-1190s1c1
Sequence:CCGGCATCTCCAGTGAAGCCAAAGACTCGAGTCTTTGGCTTCACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003684.3-984s1c1
Sequence:CCGGCAGGCCACATTCTACGACAAGCTCGAGCTTGTCGTAGAATGTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-2212s1c1
Sequence:CCGGGCTGCTAAAGTCAGTAGTATCCTCGAGGATACTACTGACTTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2489s1c1
Sequence:CCGGGCAGTTAGATAGTGCTCTGTGCTCGAGCACAGAGCACTATCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003684.3-2275s1c1
Sequence:CCGGCCAGCAAAGATGATACCTTAACTCGAGTTAAGGTATCATCTTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-284s1c1
Sequence:CCGGGCCAGGAAAGTTTGAAGATATCTCGAGATATCTTCAAACTTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003684.3-1404s1c1
Sequence:CCGGCAGCACGAAGAGAACGAACTACTCGAGTAGTTCGTTCTCTTCGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003684.3-455s1c1
Sequence:CCGGGCTGTATCAGTGTCAGGGAAACTCGAGTTTCCCTGACACTGATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks