EMAIL THIS PAGE TO A FRIEND

MKRN2

makorin ring finger protein 2

Synonyms: RNF62
Gene ID:
Human(23609) Summary: This gene encodes a probable E3 ubiquitin ligase containing several zinc finger domains, that is a member of the makorin RING zinc-finger protein family. This gene overlaps the v-raf-1 murine leukemia viral oncogene homolog 1 (RAF1) gene in an antisense orientation and may have a co-regulatory function with RAF1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(67027) makorin, ring finger protein, 2
Rat(297525) makorin, ring finger protein, 2
sheep(101103765) makorin ring finger protein 2
Domestic Rabbit(100340148) makorin ring finger protein 2
naked mole-rat(101722891) makorin ring finger protein 2
domestic guinea pig(100714537) makorin ring finger protein 2
Zebrafish(170783) makorin, ring finger protein, 2
chicken(374162) makorin ring finger protein 2
domestic cat(101096301) makorin ring finger protein 2
cow(508004) makorin ring finger protein 2
Horse(100057038) makorin ring finger protein 2
dog(476531) makorin ring finger protein 2
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014160 Rosetta Predictions human pricing
NM_001008314 Rosetta Predictions rat pricing
NM_023290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246991 predicted 755
2 SASI_Hs01_00246992 predicted 1118
3 SASI_Hs01_00246993 predicted 1287
4 SASI_Hs01_00246994 predicted 990
5 SASI_Hs01_00246995 predicted 765
6 SASI_Hs01_00246997 predicted 815
7 SASI_Hs01_00246998 predicted 1031
8 SASI_Hs01_00246999 predicted 359
9 SASI_Hs02_00345152 predicted 1190
10 SASI_Hs01_00247000 predicted 1070
11 SASI_Hs01_00246996 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065934 predicted 332
2 SASI_Rn01_00065935 predicted 1091
3 SASI_Rn01_00065936 predicted 259
4 SASI_Rn01_00065937 predicted 724
5 SASI_Rn01_00065938 predicted 879
6 SASI_Rn01_00065939 predicted 907
7 SASI_Rn01_00065940 predicted 1236
8 SASI_Rn01_00065941 predicted 707
9 SASI_Rn01_00065942 predicted 636
10 SASI_Rn01_00065943 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327025 predicted 383
2 SASI_Mm01_00145656 predicted 979
3 SASI_Mm02_00327026 predicted 752
4 SASI_Mm02_00327027 predicted 299
5 SASI_Mm01_00145657 predicted 925
6 SASI_Mm01_00145658 predicted 1070
7 SASI_Mm02_00327028 predicted 198
8 SASI_Mm02_00327029 predicted 959
9 SASI_Mm01_00145664 predicted 1393
10 SASI_Mm01_00145665 predicted 666
11 SASI_Mm01_00145659 predicted 302
12 SASI_Mm01_00145660 predicted 690
13 SASI_Mm01_00145661 predicted 1277
14 SASI_Mm01_00145662 predicted 694
15 SASI_Mm01_00145663 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023290
VALIDATED
MKRN2 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-1412s1c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-386s1c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-118s1c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-893s1c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-272s1c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-304s21c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-150s21c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-925s21c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-418s21c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023290.2-1444s21c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023290
VALIDATED
MKRN2 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-1412s1c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-386s1c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-118s1c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-893s1c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-272s1c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-304s21c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-150s21c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-925s21c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-418s21c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023290.2-1444s21c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023290
VALIDATED
MKRN2 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-1412s1c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-386s1c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-118s1c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-893s1c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023290.1-272s1c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-304s21c1
Sequence:CCGGCCTGACATTGCCACATCTGTTCTCGAGAACAGATGTGGCAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-150s21c1
Sequence:CCGGGTCCACCATCTGCAAATACTACTCGAGTAGTATTTGCAGATGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-925s21c1
Sequence:CCGGCGTGTGATATCAGAGTTTGTACTCGAGTACAAACTCTGATATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023290.2-418s21c1
Sequence:CCGGCCTCCAAGCAAAGTGAATAATCTCGAGATTATTCACTTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023290.2-1444s21c1
Sequence:CCGGCGTCCACAGAATCACTACATTCTCGAGAATGTAGTGATTCTGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014160
VALIDATED
MKRN2 MISSION shRNA Bacterial Glycerol Stock
makorin ring finger protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-193s1c1
Sequence:CCGGCCTATGGAACTCGGTGCAGATCTCGAGATCTGCACCGAGTTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1263s1c1
Sequence:CCGGGACCTCTTCATGCACCTTTCTCTCGAGAGAAAGGTGCATGAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1927s1c1
Sequence:CCGGCAGCAAACAAAGTGGAAGTATCTCGAGATACTTCCACTTTGTTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-919s1c1
Sequence:CCGGGTCCAGAATGCCGTGTGATATCTCGAGATATCACACGGCATTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014160.x-848s1c1
Sequence:CCGGCACGTACTGTTTGTCCTGCATCTCGAGATGCAGGACAAACAGTACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014160.3-1696s21c1
Sequence:CCGGAGGAGTCTTCAGCCCTATAAACTCGAGTTTATAGGGCTGAAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-375s21c1
Sequence:CCGGTTGGTTCTTAGAGACCGAAATCTCGAGATTTCGGTCTCTAAGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-994s21c1
Sequence:CCGGAGTTGATTGAAGCTTTCAAACCTCGAGGTTTGAAAGCTTCAATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-966s21c1
Sequence:CCGGTGGGTGGAAGATCAGAATAAACTCGAGTTTATTCTGATCTTCCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014160
VALIDATED
MKRN2 MISSION shRNA shRNA Plasmid DNA
makorin ring finger protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-193s1c1
Sequence:CCGGCCTATGGAACTCGGTGCAGATCTCGAGATCTGCACCGAGTTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1263s1c1
Sequence:CCGGGACCTCTTCATGCACCTTTCTCTCGAGAGAAAGGTGCATGAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1927s1c1
Sequence:CCGGCAGCAAACAAAGTGGAAGTATCTCGAGATACTTCCACTTTGTTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-919s1c1
Sequence:CCGGGTCCAGAATGCCGTGTGATATCTCGAGATATCACACGGCATTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014160.x-848s1c1
Sequence:CCGGCACGTACTGTTTGTCCTGCATCTCGAGATGCAGGACAAACAGTACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014160.3-1696s21c1
Sequence:CCGGAGGAGTCTTCAGCCCTATAAACTCGAGTTTATAGGGCTGAAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-375s21c1
Sequence:CCGGTTGGTTCTTAGAGACCGAAATCTCGAGATTTCGGTCTCTAAGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-994s21c1
Sequence:CCGGAGTTGATTGAAGCTTTCAAACCTCGAGGTTTGAAAGCTTCAATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-966s21c1
Sequence:CCGGTGGGTGGAAGATCAGAATAAACTCGAGTTTATTCTGATCTTCCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014160
VALIDATED
MKRN2 MISSION shRNA Lentiviral Transduction Particles
makorin ring finger protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-193s1c1
Sequence:CCGGCCTATGGAACTCGGTGCAGATCTCGAGATCTGCACCGAGTTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1263s1c1
Sequence:CCGGGACCTCTTCATGCACCTTTCTCTCGAGAGAAAGGTGCATGAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-1927s1c1
Sequence:CCGGCAGCAAACAAAGTGGAAGTATCTCGAGATACTTCCACTTTGTTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_014160.x-919s1c1
Sequence:CCGGGTCCAGAATGCCGTGTGATATCTCGAGATATCACACGGCATTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014160.x-848s1c1
Sequence:CCGGCACGTACTGTTTGTCCTGCATCTCGAGATGCAGGACAAACAGTACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014160.3-1696s21c1
Sequence:CCGGAGGAGTCTTCAGCCCTATAAACTCGAGTTTATAGGGCTGAAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-375s21c1
Sequence:CCGGTTGGTTCTTAGAGACCGAAATCTCGAGATTTCGGTCTCTAAGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-994s21c1
Sequence:CCGGAGTTGATTGAAGCTTTCAAACCTCGAGGTTTGAAAGCTTCAATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014160.3-966s21c1
Sequence:CCGGTGGGTGGAAGATCAGAATAAACTCGAGTTTATTCTGATCTTCCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks