EMAIL THIS PAGE TO A FRIEND

MLANA

melan-A

Synonyms: MART-1 MART1
UniProtKB ID: Q16655, Q6ICU4
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_129166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005511 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009801 MISSION® esiRNA esiRNA targeting human MLANA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005511 Rosetta Predictions human pricing
NM_001106348 Rosetta Predictions rat pricing
NM_029993 Rosetta Predictions mouse pricing
XM_129166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243582 predicted 519
2 SASI_Hs01_00243583 predicted 687
3 SASI_Hs01_00243584 predicted 563
4 SASI_Hs01_00243585 predicted 293
5 SASI_Hs02_00339725 predicted 231
6 SASI_Hs01_00243586 predicted 476
7 SASI_Hs01_00243587 predicted 661
8 SASI_Hs01_00243588 predicted 669
9 SASI_Hs01_00243589 predicted 696
10 SASI_Hs01_00243590 predicted 642
11 SASI_Hs01_00243591 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218088 predicted 437
2 SASI_Rn02_00218089 predicted 350
3 SASI_Rn02_00218090 predicted 397
4 SASI_Rn02_00218091 predicted 372
5 SASI_Rn02_00218092 predicted 314
6 SASI_Rn02_00218093 predicted 370
7 SASI_Rn02_00218094 predicted 498
8 SASI_Rn02_00218095 predicted 493
9 SASI_Rn02_00218096 predicted 438
10 SASI_Rn02_00218097 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336350 predicted 213
2 SASI_Mm02_00336351 predicted 196
3 SASI_Mm02_00336352 predicted 91
4 SASI_Mm02_00336353 predicted 400
5 SASI_Mm02_00336354 predicted 194
6 SASI_Mm02_00336355 predicted 250
7 SASI_Mm02_00336356 predicted 156
8 SASI_Mm02_00336357 predicted 174
9 SASI_Mm02_00336358 predicted 287
10 SASI_Mm02_00336359 predicted 96
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222023 predicted 611
2 SASI_Mm01_00222024 predicted 524
3 SASI_Mm01_00222025 predicted 656
4 SASI_Mm01_00222026 predicted 311
5 SASI_Mm01_00222027 predicted 370
6 SASI_Mm01_00222028 predicted 285
7 SASI_Mm01_00222029 predicted 600
8 SASI_Mm01_00222030 predicted 660
9 SASI_Mm01_00222031 predicted 557
10 SASI_Mm01_00222032 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129166
MLANA MISSION shRNA Bacterial Glycerol Stock
melan-A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-212s1c1
Sequence:CCGGCGCTCCTATGTCACTGCTGAACTCGAGTTCAGCAGTGACATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-291s1c1
Sequence:CCGGGCTGGTACTGTAGAAGACGAACTCGAGTTCGTCTTCTACAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-338s1c1
Sequence:CCGGAGGCGTCATATTGGTATTCAACTCGAGTTGAATACCAATATGACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-464s1c1
Sequence:CCGGGCCTATGAGAAGCTCTCTTCACTCGAGTGAAGAGAGCTTCTCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129166.1-548s1c1
Sequence:CCGGCTTCCGCTTTAAGGCTGAGTACTCGAGTACTCAGCCTTAAAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129166
MLANA MISSION shRNA shRNA Plasmid DNA
melan-A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-212s1c1
Sequence:CCGGCGCTCCTATGTCACTGCTGAACTCGAGTTCAGCAGTGACATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-291s1c1
Sequence:CCGGGCTGGTACTGTAGAAGACGAACTCGAGTTCGTCTTCTACAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-338s1c1
Sequence:CCGGAGGCGTCATATTGGTATTCAACTCGAGTTGAATACCAATATGACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-464s1c1
Sequence:CCGGGCCTATGAGAAGCTCTCTTCACTCGAGTGAAGAGAGCTTCTCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129166.1-548s1c1
Sequence:CCGGCTTCCGCTTTAAGGCTGAGTACTCGAGTACTCAGCCTTAAAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129166
MLANA MISSION shRNA Lentiviral Transduction Particles
melan-A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-212s1c1
Sequence:CCGGCGCTCCTATGTCACTGCTGAACTCGAGTTCAGCAGTGACATAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-291s1c1
Sequence:CCGGGCTGGTACTGTAGAAGACGAACTCGAGTTCGTCTTCTACAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-338s1c1
Sequence:CCGGAGGCGTCATATTGGTATTCAACTCGAGTTGAATACCAATATGACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129166.1-464s1c1
Sequence:CCGGGCCTATGAGAAGCTCTCTTCACTCGAGTGAAGAGAGCTTCTCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129166.1-548s1c1
Sequence:CCGGCTTCCGCTTTAAGGCTGAGTACTCGAGTACTCAGCCTTAAAGCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005511
MLANA MISSION shRNA Bacterial Glycerol Stock
melan-A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-304s1c1
Sequence:CCGGGCAAAGTGTCTCTTCAAGAGACTCGAGTCTCTTGAAGAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-305s1c1
Sequence:CCGGCAAAGTGTCTCTTCAAGAGAACTCGAGTTCTCTTGAAGAGACACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-360s1c1
Sequence:CCGGGCTTATGAGAAACTCTCTGCACTCGAGTGCAGAGAGTTTCTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-252s1c1
Sequence:CCGGCAATGTGCCTTAACAAGAAGACTCGAGTCTTCTTGTTAAGGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-276s1c1
Sequence:CCGGCCACAAGAAGGGTTTGATCATCTCGAGATGATCAAACCCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-357s1c1
Sequence:CCGGCCTGCTTATGAGAAACTCTCTCTCGAGAGAGAGTTTCTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1358s1c1
Sequence:CCGGCCAGAAATTGGTAGAAGGATTCTCGAGAATCCTTCTACCAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-654s1c1
Sequence:CCGGGCCAGAGGTAATGTTAGTAAACTCGAGTTTACTAACATTACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-204s1c1
Sequence:CCGGCGAAATGGATACAGAGCCTTGCTCGAGCAAGGCTCTGTATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1109s1c1
Sequence:CCGGCGCCACTATGCCTGACTAATTCTCGAGAATTAGTCAGGCATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005511
MLANA MISSION shRNA shRNA Plasmid DNA
melan-A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-304s1c1
Sequence:CCGGGCAAAGTGTCTCTTCAAGAGACTCGAGTCTCTTGAAGAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-305s1c1
Sequence:CCGGCAAAGTGTCTCTTCAAGAGAACTCGAGTTCTCTTGAAGAGACACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-360s1c1
Sequence:CCGGGCTTATGAGAAACTCTCTGCACTCGAGTGCAGAGAGTTTCTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-252s1c1
Sequence:CCGGCAATGTGCCTTAACAAGAAGACTCGAGTCTTCTTGTTAAGGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-276s1c1
Sequence:CCGGCCACAAGAAGGGTTTGATCATCTCGAGATGATCAAACCCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-357s1c1
Sequence:CCGGCCTGCTTATGAGAAACTCTCTCTCGAGAGAGAGTTTCTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1358s1c1
Sequence:CCGGCCAGAAATTGGTAGAAGGATTCTCGAGAATCCTTCTACCAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-654s1c1
Sequence:CCGGGCCAGAGGTAATGTTAGTAAACTCGAGTTTACTAACATTACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-204s1c1
Sequence:CCGGCGAAATGGATACAGAGCCTTGCTCGAGCAAGGCTCTGTATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1109s1c1
Sequence:CCGGCGCCACTATGCCTGACTAATTCTCGAGAATTAGTCAGGCATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005511
MLANA MISSION shRNA Lentiviral Transduction Particles
melan-A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-304s1c1
Sequence:CCGGGCAAAGTGTCTCTTCAAGAGACTCGAGTCTCTTGAAGAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-305s1c1
Sequence:CCGGCAAAGTGTCTCTTCAAGAGAACTCGAGTTCTCTTGAAGAGACACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005511.1-360s1c1
Sequence:CCGGGCTTATGAGAAACTCTCTGCACTCGAGTGCAGAGAGTTTCTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-252s1c1
Sequence:CCGGCAATGTGCCTTAACAAGAAGACTCGAGTCTTCTTGTTAAGGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-276s1c1
Sequence:CCGGCCACAAGAAGGGTTTGATCATCTCGAGATGATCAAACCCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-357s1c1
Sequence:CCGGCCTGCTTATGAGAAACTCTCTCTCGAGAGAGAGTTTCTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1358s1c1
Sequence:CCGGCCAGAAATTGGTAGAAGGATTCTCGAGAATCCTTCTACCAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-654s1c1
Sequence:CCGGGCCAGAGGTAATGTTAGTAAACTCGAGTTTACTAACATTACCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005511.1-204s1c1
Sequence:CCGGCGAAATGGATACAGAGCCTTGCTCGAGCAAGGCTCTGTATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005511.1-1109s1c1
Sequence:CCGGCGCCACTATGCCTGACTAATTCTCGAGAATTAGTCAGGCATAGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks