EMAIL THIS PAGE TO A FRIEND

MLLT4-AS1

MLLT4 antisense RNA 1 (head to head)

Synonyms: C6orf124 HGC6.4 dJ431P23.3
Species: Human MLLT4-AS1(653483)
UniProtKB ID: Q9Y6Z5, B4DW86, Q8NB23
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127311 MISSION® esiRNA esiRNA human C6orf124 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042508 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310228 predicted 1108
2 SASI_Hs02_00310229 predicted 1551
3 SASI_Hs02_00310230 predicted 1222
4 SASI_Hs02_00310231 predicted 1012
5 SASI_Hs02_00310232 predicted 1593
6 SASI_Hs02_00310233 predicted 1292
7 SASI_Hs02_00310234 predicted 1277
8 SASI_Hs02_00310235 predicted 1561
9 SASI_Hs02_00310236 predicted 1250
10 SASI_Hs02_00310237 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042508
VALIDATED
MLLT4-AS1 MISSION shRNA Bacterial Glycerol Stock
MLLT4 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1041s21c1
Sequence:CCGGTTCCGCTGGGTCACTTCAAAGCTCGAGCTTTGAAGTGACCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-1102s21c1
Sequence:CCGGGTTAGGCTTTGTGTGCATTTCCTCGAGGAAATGCACACAAAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1366s21c1
Sequence:CCGGGATGCCACGTGATCGTCATTTCTCGAGAAATGACGATCACGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-709s21c1
Sequence:CCGGCTGGCGGTGCTGGGTCTAAATCTCGAGATTTAGACCCAGCACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-519s21c1
Sequence:CCGGATGGGTGGTGCTAGGTCTAAACTCGAGTTTAGACCTAGCACCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042508
VALIDATED
MLLT4-AS1 MISSION shRNA shRNA Plasmid DNA
MLLT4 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1041s21c1
Sequence:CCGGTTCCGCTGGGTCACTTCAAAGCTCGAGCTTTGAAGTGACCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-1102s21c1
Sequence:CCGGGTTAGGCTTTGTGTGCATTTCCTCGAGGAAATGCACACAAAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1366s21c1
Sequence:CCGGGATGCCACGTGATCGTCATTTCTCGAGAAATGACGATCACGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-709s21c1
Sequence:CCGGCTGGCGGTGCTGGGTCTAAATCTCGAGATTTAGACCCAGCACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-519s21c1
Sequence:CCGGATGGGTGGTGCTAGGTCTAAACTCGAGTTTAGACCTAGCACCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042508
VALIDATED
MLLT4-AS1 MISSION shRNA Lentiviral Transduction Particles
MLLT4 antisense RNA 1 (head to head)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1041s21c1
Sequence:CCGGTTCCGCTGGGTCACTTCAAAGCTCGAGCTTTGAAGTGACCCAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-1102s21c1
Sequence:CCGGGTTAGGCTTTGTGTGCATTTCCTCGAGGAAATGCACACAAAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-1366s21c1
Sequence:CCGGGATGCCACGTGATCGTCATTTCTCGAGAAATGACGATCACGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042508.3-709s21c1
Sequence:CCGGCTGGCGGTGCTGGGTCTAAATCTCGAGATTTAGACCCAGCACCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042508.3-519s21c1
Sequence:CCGGATGGGTGGTGCTAGGTCTAAACTCGAGTTTAGACCTAGCACCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks