EMAIL THIS PAGE TO A FRIEND

MLLT6

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6

Synonyms: AF17
UniProtKB ID: P55198, Q59F28, Q96IU3, Q9H5F6, Q9UF49
Gene ID:
Mouse(246198) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Rat(303504) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
chicken(419995) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
dog(608565) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
domestic cat(101099601) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
cow(538601) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
naked mole-rat(101723061) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
domestic guinea pig(100718935) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
sheep(101102576) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005937 Rosetta Predictions human pricing
XM_001081378 Rosetta Predictions rat pricing
XM_239329 Rosetta Predictions rat pricing
NM_139311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052019 predicted 3639
2 SASI_Hs01_00052020 predicted 2002
3 SASI_Hs01_00052021 predicted 225
4 SASI_Hs01_00052022 predicted 3730
5 SASI_Hs01_00052023 predicted 1654
6 SASI_Hs01_00052024 predicted 354
7 SASI_Hs01_00052025 predicted 720
8 SASI_Hs01_00052027 predicted 3624
9 SASI_Hs02_00340597 predicted 436
10 SASI_Hs02_00340598 predicted 331
11 SASI_Hs01_00052018 predicted 454
12 SASI_Hs01_00052026 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371659 predicted 2385
2 SASI_Rn02_00371660 predicted 3114
3 SASI_Rn02_00371661 predicted 3956
4 SASI_Rn02_00371662 predicted 1677
5 SASI_Rn02_00371663 predicted 3912
6 SASI_Rn02_00371664 predicted 673
7 SASI_Rn02_00371665 predicted 4090
8 SASI_Rn02_00371666 predicted 1775
9 SASI_Rn02_00371667 predicted 553
10 SASI_Rn02_00371668 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391504 predicted 678
2 SASI_Rn02_00391505 predicted 257
3 SASI_Rn02_00391506 predicted 2700
4 SASI_Rn02_00391507 predicted 3537
5 SASI_Rn02_00391508 predicted 1243
6 SASI_Rn02_00391509 predicted 3496
7 SASI_Rn02_00391510 predicted 241
8 SASI_Rn02_00391511 predicted 1345
9 SASI_Rn02_00391512 predicted 432
10 SASI_Rn02_00391513 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340022 predicted 1983
2 SASI_Mm01_00028763 predicted 495
3 SASI_Mm01_00028764 predicted 3712
4 SASI_Mm02_00340023 predicted 1285
5 SASI_Mm02_00340024 predicted 379
6 SASI_Mm01_00028765 predicted 3543
7 SASI_Mm01_00028767 predicted 2475
8 SASI_Mm01_00028768 predicted 3855
9 SASI_Mm01_00028769 predicted 424
10 SASI_Mm01_00028770 predicted 3684
11 SASI_Mm01_00028761 predicted 2131
12 SASI_Mm01_00028762 predicted 1918
13 SASI_Mm01_00028766 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005937
MLLT6 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-926s21c1
Sequence:CCGGAGCCATAGCCTGAGTCATAAACTCGAGTTTATGACTCAGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-1662s21c1
Sequence:CCGGCAGGCATCTACACCAGTAATACTCGAGTATTACTGGTGTAGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-234s21c1
Sequence:CCGGCATTGAAGAGGACTGATAATGCTCGAGCATTATCAGTCCTCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-528s21c1
Sequence:CCGGAGTACTGCGGCTACTGCAAATCTCGAGATTTGCAGTAGCCGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-522s1c1
Sequence:CCGGCGGCTACTGCAAATACCACTTCTCGAGAAGTGGTATTTGCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2145s1c1
Sequence:CCGGCGGCGTCAACATCGTGGAGATCTCGAGATCTCCACGATGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-220s1c1
Sequence:CCGGGCATTGAAGAGGACTGATAATCTCGAGATTATCAGTCCTCTTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-921s1c1
Sequence:CCGGCCTGAGTCATAAAGGGAAGAACTCGAGTTCTTCCCTTTATGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2889s1c1
Sequence:CCGGCCAGACTGTTGTCTACCAGATCTCGAGATCTGGTAGACAACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005937
MLLT6 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-926s21c1
Sequence:CCGGAGCCATAGCCTGAGTCATAAACTCGAGTTTATGACTCAGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-1662s21c1
Sequence:CCGGCAGGCATCTACACCAGTAATACTCGAGTATTACTGGTGTAGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-234s21c1
Sequence:CCGGCATTGAAGAGGACTGATAATGCTCGAGCATTATCAGTCCTCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-528s21c1
Sequence:CCGGAGTACTGCGGCTACTGCAAATCTCGAGATTTGCAGTAGCCGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-522s1c1
Sequence:CCGGCGGCTACTGCAAATACCACTTCTCGAGAAGTGGTATTTGCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2145s1c1
Sequence:CCGGCGGCGTCAACATCGTGGAGATCTCGAGATCTCCACGATGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-220s1c1
Sequence:CCGGGCATTGAAGAGGACTGATAATCTCGAGATTATCAGTCCTCTTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-921s1c1
Sequence:CCGGCCTGAGTCATAAAGGGAAGAACTCGAGTTCTTCCCTTTATGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2889s1c1
Sequence:CCGGCCAGACTGTTGTCTACCAGATCTCGAGATCTGGTAGACAACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005937
MLLT6 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-926s21c1
Sequence:CCGGAGCCATAGCCTGAGTCATAAACTCGAGTTTATGACTCAGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-1662s21c1
Sequence:CCGGCAGGCATCTACACCAGTAATACTCGAGTATTACTGGTGTAGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-234s21c1
Sequence:CCGGCATTGAAGAGGACTGATAATGCTCGAGCATTATCAGTCCTCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005937.3-528s21c1
Sequence:CCGGAGTACTGCGGCTACTGCAAATCTCGAGATTTGCAGTAGCCGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-522s1c1
Sequence:CCGGCGGCTACTGCAAATACCACTTCTCGAGAAGTGGTATTTGCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2145s1c1
Sequence:CCGGCGGCGTCAACATCGTGGAGATCTCGAGATCTCCACGATGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-220s1c1
Sequence:CCGGGCATTGAAGAGGACTGATAATCTCGAGATTATCAGTCCTCTTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-921s1c1
Sequence:CCGGCCTGAGTCATAAAGGGAAGAACTCGAGTTCTTCCCTTTATGACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005937.1-2889s1c1
Sequence:CCGGCCAGACTGTTGTCTACCAGATCTCGAGATCTGGTAGACAACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139311
MLLT6 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1916s1c1
Sequence:CCGGGCAGGCATCTATACCAGTAATCTCGAGATTACTGGTATAGATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1271s1c1
Sequence:CCGGCTGAGTCATAAGGACAAGAAACTCGAGTTTCTTGTCCTTATGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139311.1-4294s1c1
Sequence:CCGGCCTGTCTGTCTATCTGTCATTCTCGAGAATGACAGATAGACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1269s1c1
Sequence:CCGGGCCTGAGTCATAAGGACAAGACTCGAGTCTTGTCCTTATGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1076s1c1
Sequence:CCGGCGAAAGGACAAAGAACGCCTTCTCGAGAAGGCGTTCTTTGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139311
MLLT6 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1916s1c1
Sequence:CCGGGCAGGCATCTATACCAGTAATCTCGAGATTACTGGTATAGATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1271s1c1
Sequence:CCGGCTGAGTCATAAGGACAAGAAACTCGAGTTTCTTGTCCTTATGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139311.1-4294s1c1
Sequence:CCGGCCTGTCTGTCTATCTGTCATTCTCGAGAATGACAGATAGACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1269s1c1
Sequence:CCGGGCCTGAGTCATAAGGACAAGACTCGAGTCTTGTCCTTATGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1076s1c1
Sequence:CCGGCGAAAGGACAAAGAACGCCTTCTCGAGAAGGCGTTCTTTGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139311
MLLT6 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1916s1c1
Sequence:CCGGGCAGGCATCTATACCAGTAATCTCGAGATTACTGGTATAGATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1271s1c1
Sequence:CCGGCTGAGTCATAAGGACAAGAAACTCGAGTTTCTTGTCCTTATGACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139311.1-4294s1c1
Sequence:CCGGCCTGTCTGTCTATCTGTCATTCTCGAGAATGACAGATAGACAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1269s1c1
Sequence:CCGGGCCTGAGTCATAAGGACAAGACTCGAGTCTTGTCCTTATGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139311.1-1076s1c1
Sequence:CCGGCGAAAGGACAAAGAACGCCTTCTCGAGAAGGCGTTCTTTGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks