EMAIL THIS PAGE TO A FRIEND

MLXIPL

MLX interacting protein-like

Synonyms: CHREBP MIO MONDOB WBSCR14 WS-bHLH bHLHd14
Gene ID:
Human(51085) Summary: This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(58805) MLX interacting protein-like
Rat(171078) MLX interacting protein-like
sheep(101115503) MLX interacting protein-like
domestic guinea pig(100730636) MLX interacting protein-like
naked mole-rat(101703432) MLX interacting protein-like
chicken(101751014) MLX interacting protein-like
dog(489807) MLX interacting protein-like
Horse(100059888) MLX interacting protein-like
cow(788534) MLX interacting protein-like
domestic cat(101096372) MLX interacting protein-like
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032951 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032951 Rosetta Predictions human pricing
NM_032952 Rosetta Predictions human pricing
NM_032953 Rosetta Predictions human pricing
NM_032954 Rosetta Predictions human pricing
NM_133552 Rosetta Predictions rat pricing
NM_021455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057276 predicted 426
2 SASI_Hs01_00057277 predicted 293
3 SASI_Hs01_00057278 predicted 418
4 SASI_Hs01_00057279 predicted 294
5 SASI_Hs01_00057280 predicted 933
6 SASI_Hs01_00057281 predicted 937
7 SASI_Hs01_00057282 predicted 334
8 SASI_Hs01_00057283 predicted 335
9 SASI_Hs01_00057284 predicted 571
10 SASI_Hs01_00057285 predicted 2415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180337 predicted 430
2 SASI_Hs01_00180338 predicted 296
3 SASI_Hs01_00180339 predicted 422
4 SASI_Hs01_00180340 predicted 298
5 SASI_Hs01_00180341 predicted 933
6 SASI_Hs01_00180342 predicted 933
7 SASI_Hs01_00180343 predicted 330
8 SASI_Hs01_00180344 predicted 343
9 SASI_Hs01_00180345 predicted 573
10 SASI_Hs01_00180346 predicted 2357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200987 predicted 428
2 SASI_Hs01_00200988 predicted 292
3 SASI_Hs01_00200989 predicted 417
4 SASI_Hs01_00200990 predicted 299
5 SASI_Hs01_00200991 predicted 934
6 SASI_Hs01_00200992 predicted 936
7 SASI_Hs01_00200993 predicted 328
8 SASI_Hs01_00200994 predicted 335
9 SASI_Hs01_00200995 predicted 569
10 SASI_Hs01_00200996 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217422 predicted 430
2 SASI_Hs01_00217423 predicted 294
3 SASI_Hs01_00217424 predicted 417
4 SASI_Hs01_00217425 predicted 301
5 SASI_Hs01_00217426 predicted 934
6 SASI_Hs01_00217427 predicted 937
7 SASI_Hs01_00217428 predicted 333
8 SASI_Hs01_00217429 predicted 342
9 SASI_Hs01_00217430 predicted 569
10 SASI_Hs01_00217431 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113991 predicted 2305
2 SASI_Rn01_00113992 predicted 451
3 SASI_Rn01_00113993 predicted 850
4 SASI_Rn01_00113994 predicted 1246
5 SASI_Rn01_00113995 predicted 835
6 SASI_Rn01_00113996 predicted 1406
7 SASI_Rn01_00113997 predicted 2393
8 SASI_Rn02_00267740 predicted 1164
9 SASI_Rn01_00113998 predicted 915
10 SASI_Rn02_00267741 predicted 1182
11 SASI_Rn01_00113999 predicted 2045
12 SASI_Rn01_00114000 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102965 predicted 884
2 SASI_Mm02_00326105 predicted 899
3 SASI_Mm01_00102966 predicted 2594
4 SASI_Mm01_00102967 predicted 2364
5 SASI_Mm01_00102969 predicted 2490
6 SASI_Mm01_00102970 predicted 894
7 SASI_Mm01_00102971 predicted 1151
8 SASI_Mm01_00102972 predicted 1711
9 SASI_Mm01_00102973 predicted 546
10 SASI_Mm01_00102974 predicted 2260
11 SASI_Mm01_00102968 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032951
MLXIPL MISSION shRNA Bacterial Glycerol Stock
MLX interacting protein-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2137s1c1
Sequence:CCGGGCTGAGTACATCCTTATGCTACTCGAGTAGCATAAGGATGTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-693s1c1
Sequence:CCGGGCAATGGTGCAAACAGCTCTTCTCGAGAAGAGCTGTTTGCACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-1155s1c1
Sequence:CCGGCGCCTTCCTGAGTTCTGATTTCTCGAGAAATCAGAACTCAGGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2376s1c1
Sequence:CCGGGCCTCTGTTTGAGTCCTTCAACTCGAGTTGAAGGACTCAAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-358s1c1
Sequence:CCGGCCCAAGTGGAAGAATTTCAAACTCGAGTTTGAAATTCTTCCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2587s21c1
Sequence:CCGGACCCTTGGCAAACCTTTATAGCTCGAGCTATAAAGGTTTGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2215s21c1
Sequence:CCGGGAGCTCAATGCCGCCATTAACCTCGAGGTTAATGGCGGCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2291s21c1
Sequence:CCGGACCAGATGCGAGACATGTTTGCTCGAGCAAACATGTCTCGCATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032951
MLXIPL MISSION shRNA shRNA Plasmid DNA
MLX interacting protein-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2137s1c1
Sequence:CCGGGCTGAGTACATCCTTATGCTACTCGAGTAGCATAAGGATGTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-693s1c1
Sequence:CCGGGCAATGGTGCAAACAGCTCTTCTCGAGAAGAGCTGTTTGCACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-1155s1c1
Sequence:CCGGCGCCTTCCTGAGTTCTGATTTCTCGAGAAATCAGAACTCAGGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2376s1c1
Sequence:CCGGGCCTCTGTTTGAGTCCTTCAACTCGAGTTGAAGGACTCAAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-358s1c1
Sequence:CCGGCCCAAGTGGAAGAATTTCAAACTCGAGTTTGAAATTCTTCCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2587s21c1
Sequence:CCGGACCCTTGGCAAACCTTTATAGCTCGAGCTATAAAGGTTTGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2215s21c1
Sequence:CCGGGAGCTCAATGCCGCCATTAACCTCGAGGTTAATGGCGGCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2291s21c1
Sequence:CCGGACCAGATGCGAGACATGTTTGCTCGAGCAAACATGTCTCGCATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032951
MLXIPL MISSION shRNA Lentiviral Transduction Particles
MLX interacting protein-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2137s1c1
Sequence:CCGGGCTGAGTACATCCTTATGCTACTCGAGTAGCATAAGGATGTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-693s1c1
Sequence:CCGGGCAATGGTGCAAACAGCTCTTCTCGAGAAGAGCTGTTTGCACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-1155s1c1
Sequence:CCGGCGCCTTCCTGAGTTCTGATTTCTCGAGAAATCAGAACTCAGGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-2376s1c1
Sequence:CCGGGCCTCTGTTTGAGTCCTTCAACTCGAGTTGAAGGACTCAAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032951.1-358s1c1
Sequence:CCGGCCCAAGTGGAAGAATTTCAAACTCGAGTTTGAAATTCTTCCACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2587s21c1
Sequence:CCGGACCCTTGGCAAACCTTTATAGCTCGAGCTATAAAGGTTTGCCAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2215s21c1
Sequence:CCGGGAGCTCAATGCCGCCATTAACCTCGAGGTTAATGGCGGCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032951.2-2291s21c1
Sequence:CCGGACCAGATGCGAGACATGTTTGCTCGAGCAAACATGTCTCGCATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021455
VALIDATED
MLXIPL MISSION shRNA Bacterial Glycerol Stock
MLX interacting protein-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021455.2-3407s1c1
Sequence:CCGGCCTCTGGAATACTGGAATTAACTCGAGTTAATTCCAGTATTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1290s1c1
Sequence:CCGGCCTCTTTGTTGCCAGAAGAATCTCGAGATTCTTCTGGCAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-943s1c1
Sequence:CCGGACCCACATCTTCAAACTACATCTCGAGATGTAGTTTGAAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021455.2-2361s1c1
Sequence:CCGGGCATCCTCATCCGACCTTTATCTCGAGATAAAGGTCGGATGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1709s1c1
Sequence:CCGGCCGCAGGATACAGTTTCTGAACTCGAGTTCAGAAACTGTATCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-2022s21c1
Sequence:GTACCGGAGAAGAGGCGGTTCAATATTACTCGAGTAATATTGAACCGCCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021455.3-2769s21c1
Sequence:CCGGATGATCCCTGGTGACTCATATCTCGAGATATGAGTCACCAGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-2360s21c1
Sequence:CCGGAGCATCCTCATCCGACCTTTACTCGAGTAAAGGTCGGATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-745s21c1
Sequence:CCGGGGACTGCTTCTTGTCCGATATCTCGAGATATCGGACAAGAAGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-496s21c1
Sequence:CCGGTGTCATCCTGGAGGGTAATTACTCGAGTAATTACCCTCCAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021455
VALIDATED
MLXIPL MISSION shRNA shRNA Plasmid DNA
MLX interacting protein-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021455.2-3407s1c1
Sequence:CCGGCCTCTGGAATACTGGAATTAACTCGAGTTAATTCCAGTATTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1290s1c1
Sequence:CCGGCCTCTTTGTTGCCAGAAGAATCTCGAGATTCTTCTGGCAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-943s1c1
Sequence:CCGGACCCACATCTTCAAACTACATCTCGAGATGTAGTTTGAAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021455.2-2361s1c1
Sequence:CCGGGCATCCTCATCCGACCTTTATCTCGAGATAAAGGTCGGATGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1709s1c1
Sequence:CCGGCCGCAGGATACAGTTTCTGAACTCGAGTTCAGAAACTGTATCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-2022s21c1
Sequence:GTACCGGAGAAGAGGCGGTTCAATATTACTCGAGTAATATTGAACCGCCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021455.3-2769s21c1
Sequence:CCGGATGATCCCTGGTGACTCATATCTCGAGATATGAGTCACCAGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-2360s21c1
Sequence:CCGGAGCATCCTCATCCGACCTTTACTCGAGTAAAGGTCGGATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-745s21c1
Sequence:CCGGGGACTGCTTCTTGTCCGATATCTCGAGATATCGGACAAGAAGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-496s21c1
Sequence:CCGGTGTCATCCTGGAGGGTAATTACTCGAGTAATTACCCTCCAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021455
VALIDATED
MLXIPL MISSION shRNA Lentiviral Transduction Particles
MLX interacting protein-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021455.2-3407s1c1
Sequence:CCGGCCTCTGGAATACTGGAATTAACTCGAGTTAATTCCAGTATTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1290s1c1
Sequence:CCGGCCTCTTTGTTGCCAGAAGAATCTCGAGATTCTTCTGGCAACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-943s1c1
Sequence:CCGGACCCACATCTTCAAACTACATCTCGAGATGTAGTTTGAAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021455.2-2361s1c1
Sequence:CCGGGCATCCTCATCCGACCTTTATCTCGAGATAAAGGTCGGATGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021455.2-1709s1c1
Sequence:CCGGCCGCAGGATACAGTTTCTGAACTCGAGTTCAGAAACTGTATCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-2022s21c1
Sequence:GTACCGGAGAAGAGGCGGTTCAATATTACTCGAGTAATATTGAACCGCCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021455.3-2769s21c1
Sequence:CCGGATGATCCCTGGTGACTCATATCTCGAGATATGAGTCACCAGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-2360s21c1
Sequence:CCGGAGCATCCTCATCCGACCTTTACTCGAGTAAAGGTCGGATGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021455.3-745s21c1
Sequence:CCGGGGACTGCTTCTTGTCCGATATCTCGAGATATCGGACAAGAAGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021455.3-496s21c1
Sequence:CCGGTGTCATCCTGGAGGGTAATTACTCGAGTAATTACCCTCCAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks