EMAIL THIS PAGE TO A FRIEND

MMP17

matrix metallopeptidase 17 (membrane-inserted)

Synonyms: MT4-MMP
UniProtKB ID: Q9ULZ9, Q14850
Gene ID:
Human(4326) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The protein encoded by this gene is considered a member of the membrane-type MMP (MT-MMP) subfamily. However, this protein is unique among the MT-MMP's in that it is a GPI-anchored protein rather than a transmembrane protein. The protein activates MMP-2 by cleavage. [provided by RefSeq, Jul 2008]
Mouse(23948) matrix metallopeptidase 17
Rat(288626) matrix metallopeptidase 17
chicken(416801) matrix metallopeptidase 17 (membrane-inserted)
domestic cat(101098897) matrix metallopeptidase 17 (membrane-inserted)
cow(513072) matrix metallopeptidase 17 (membrane-inserted)
Horse(100062342) matrix metallopeptidase 17 (membrane-inserted)
dog(609890) matrix metallopeptidase 17 (membrane-inserted)
sheep(101117966) matrix metallopeptidase 17 (membrane-inserted)
domestic guinea pig(100718894) matrix metallopeptidase 17 (membrane-inserted)
naked mole-rat(101714022) matrix metallopeptidase 17 (membrane-inserted)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016155 Rosetta Predictions human pricing
NM_001105925 Rosetta Predictions rat pricing
NM_011846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024648 predicted 1276
2 SASI_Hs01_00024650 predicted 1667
3 SASI_Hs02_00348960 predicted 1122
4 SASI_Hs01_00024651 predicted 523
5 SASI_Hs01_00024653 predicted 659
6 SASI_Hs01_00024654 predicted 806
7 SASI_Hs01_00024655 predicted 1671
8 SASI_Hs01_00024656 predicted 1283
9 SASI_Hs02_00348961 predicted 754
10 SASI_Hs01_00024647 predicted 1439
11 SASI_Hs01_00024649 predicted 1100
12 SASI_Hs01_00024652 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213892 predicted 355
2 SASI_Rn02_00213893 predicted 1351
3 SASI_Rn02_00213894 predicted 1336
4 SASI_Rn02_00213895 predicted 1771
5 SASI_Rn02_00213896 predicted 589
6 SASI_Rn02_00213897 predicted 547
7 SASI_Rn02_00213898 predicted 1146
8 SASI_Rn02_00213899 predicted 576
9 SASI_Rn02_00213900 predicted 530
10 SASI_Rn02_00213901 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201090 predicted 1293
2 SASI_Mm01_00201091 predicted 1731
3 SASI_Mm01_00201092 predicted 548
4 SASI_Mm01_00201093 predicted 582
5 SASI_Mm01_00201094 predicted 527
6 SASI_Mm01_00201095 predicted 483
7 SASI_Mm01_00201096 predicted 949
8 SASI_Mm01_00201098 predicted 1244
9 SASI_Mm01_00201099 predicted 570
10 SASI_Mm02_00321580 predicted 1400
11 SASI_Mm01_00201097 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016155
VALIDATED
MMP17 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 17 (membrane-inserted)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-319s21c1
Sequence:CCGGACGCAAGAGGAGCTGTCTAAGCTCGAGCTTAGACAGCTCCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-1313s21c1
Sequence:CCGGACTGGGTGTTCAAGGACAATACTCGAGTATTGTCCTTGAACACCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-270s1c1
Sequence:CCGGGTGGCTAAGCAGGTTCGGTTACTCGAGTAACCGAACCTGCTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1420s1c1
Sequence:CCGGGCCCACAATGACAGGACTTATCTCGAGATAAGTCCTGTCATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-582s1c1
Sequence:CCGGACTCATGTACTACGCCCTCAACTCGAGTTGAGGGCGTAGTACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1137s1c1
Sequence:CCGGCGGTGAAGCTTTCTTCTTCAACTCGAGTTGAAGAAGAAAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016155.2-1287s1c1
Sequence:CCGGCGACCACAAGATCGTCTTCTTCTCGAGAAGAAGACGATCTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016155
VALIDATED
MMP17 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 17 (membrane-inserted)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-319s21c1
Sequence:CCGGACGCAAGAGGAGCTGTCTAAGCTCGAGCTTAGACAGCTCCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-1313s21c1
Sequence:CCGGACTGGGTGTTCAAGGACAATACTCGAGTATTGTCCTTGAACACCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-270s1c1
Sequence:CCGGGTGGCTAAGCAGGTTCGGTTACTCGAGTAACCGAACCTGCTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1420s1c1
Sequence:CCGGGCCCACAATGACAGGACTTATCTCGAGATAAGTCCTGTCATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-582s1c1
Sequence:CCGGACTCATGTACTACGCCCTCAACTCGAGTTGAGGGCGTAGTACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1137s1c1
Sequence:CCGGCGGTGAAGCTTTCTTCTTCAACTCGAGTTGAAGAAGAAAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016155.2-1287s1c1
Sequence:CCGGCGACCACAAGATCGTCTTCTTCTCGAGAAGAAGACGATCTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016155
VALIDATED
MMP17 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 17 (membrane-inserted)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-319s21c1
Sequence:CCGGACGCAAGAGGAGCTGTCTAAGCTCGAGCTTAGACAGCTCCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016155.4-1313s21c1
Sequence:CCGGACTGGGTGTTCAAGGACAATACTCGAGTATTGTCCTTGAACACCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-270s1c1
Sequence:CCGGGTGGCTAAGCAGGTTCGGTTACTCGAGTAACCGAACCTGCTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1420s1c1
Sequence:CCGGGCCCACAATGACAGGACTTATCTCGAGATAAGTCCTGTCATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-582s1c1
Sequence:CCGGACTCATGTACTACGCCCTCAACTCGAGTTGAGGGCGTAGTACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016155.2-1137s1c1
Sequence:CCGGCGGTGAAGCTTTCTTCTTCAACTCGAGTTGAAGAAGAAAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016155.2-1287s1c1
Sequence:CCGGCGACCACAAGATCGTCTTCTTCTCGAGAAGAAGACGATCTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011846
MMP17 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 17 (membrane-inserted)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1262s1c1
Sequence:CCGGCGTACCAGTGACCACAAGATTCTCGAGAATCTTGTGGTCACTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-590s1c1
Sequence:CCGGCCCTTGAACTTCCACGAGGTACTCGAGTACCTCGTGGAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-551s1c1
Sequence:CCGGCTCATGTACTACGCCCTCAAACTCGAGTTTGAGGGCGTAGTACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-812s1c1
Sequence:CCGGGCCGTCCATGAGTTTGGTCATCTCGAGATGACCAAACTCATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1306s1c1
Sequence:CCGGCTGGGTGTTTAAGGACAACAACTCGAGTTGTTGTCCTTAAACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011846
MMP17 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 17 (membrane-inserted)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1262s1c1
Sequence:CCGGCGTACCAGTGACCACAAGATTCTCGAGAATCTTGTGGTCACTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-590s1c1
Sequence:CCGGCCCTTGAACTTCCACGAGGTACTCGAGTACCTCGTGGAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-551s1c1
Sequence:CCGGCTCATGTACTACGCCCTCAAACTCGAGTTTGAGGGCGTAGTACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-812s1c1
Sequence:CCGGGCCGTCCATGAGTTTGGTCATCTCGAGATGACCAAACTCATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1306s1c1
Sequence:CCGGCTGGGTGTTTAAGGACAACAACTCGAGTTGTTGTCCTTAAACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011846
MMP17 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 17 (membrane-inserted)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1262s1c1
Sequence:CCGGCGTACCAGTGACCACAAGATTCTCGAGAATCTTGTGGTCACTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-590s1c1
Sequence:CCGGCCCTTGAACTTCCACGAGGTACTCGAGTACCTCGTGGAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-551s1c1
Sequence:CCGGCTCATGTACTACGCCCTCAAACTCGAGTTTGAGGGCGTAGTACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-812s1c1
Sequence:CCGGGCCGTCCATGAGTTTGGTCATCTCGAGATGACCAAACTCATGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011846.3-1306s1c1
Sequence:CCGGCTGGGTGTTTAAGGACAACAACTCGAGTTGTTGTCCTTAAACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks