EMAIL THIS PAGE TO A FRIEND

MMP23A

matrix metallopeptidase 23A (pseudogene)

Synonyms: MIFR MIFR-1 MMP21
Species: Human MMP23A(8511), Domestic Rabbit MMP23A(100341897)
Gene ID:
Domestic Rabbit(100341897) matrix metallopeptidase 23A (pseudogene)
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002946 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377480 predicted 344
2 SASI_Hs02_00377481 predicted 559
3 SASI_Hs02_00377482 predicted 382
4 SASI_Hs02_00377483 predicted 520
5 SASI_Hs02_00377484 predicted 374
6 SASI_Hs02_00377485 predicted 354
7 SASI_Hs02_00377486 predicted 403
8 SASI_Hs02_00377487 predicted 349
9 SASI_Hs02_00377488 predicted 415
10 SASI_Hs02_00377489 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004659
MMP23A MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 23A (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-993s1c1
Sequence:CCGGCCACAAGAAAGGGAAAGTGTACTCGAGTACACTTTCCCTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-981s1c1
Sequence:CCGGCCAGAAGATCCTCCACAAGAACTCGAGTTCTTGTGGAGGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-1077s1c1
Sequence:CCGGGCACCTGAGCATCATCGCCAACTCGAGTTGGCGATGATGCTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-664s1c1
Sequence:CCGGCTGGGCCTGATGCACTCACAACTCGAGTTGTGAGTGCATCAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-285s1c1
Sequence:CCGGCCTCAACCTCACCTACAGGATCTCGAGATCCTGTAGGTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004659
MMP23A MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 23A (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-993s1c1
Sequence:CCGGCCACAAGAAAGGGAAAGTGTACTCGAGTACACTTTCCCTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-981s1c1
Sequence:CCGGCCAGAAGATCCTCCACAAGAACTCGAGTTCTTGTGGAGGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-1077s1c1
Sequence:CCGGGCACCTGAGCATCATCGCCAACTCGAGTTGGCGATGATGCTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-664s1c1
Sequence:CCGGCTGGGCCTGATGCACTCACAACTCGAGTTGTGAGTGCATCAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-285s1c1
Sequence:CCGGCCTCAACCTCACCTACAGGATCTCGAGATCCTGTAGGTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004659
MMP23A MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 23A (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-993s1c1
Sequence:CCGGCCACAAGAAAGGGAAAGTGTACTCGAGTACACTTTCCCTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-981s1c1
Sequence:CCGGCCAGAAGATCCTCCACAAGAACTCGAGTTCTTGTGGAGGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-1077s1c1
Sequence:CCGGGCACCTGAGCATCATCGCCAACTCGAGTTGGCGATGATGCTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-664s1c1
Sequence:CCGGCTGGGCCTGATGCACTCACAACTCGAGTTGTGAGTGCATCAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004659.1-285s1c1
Sequence:CCGGCCTCAACCTCACCTACAGGATCTCGAGATCCTGTAGGTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks