EMAIL THIS PAGE TO A FRIEND

MMP26

matrix metallopeptidase 26

UniProtKB ID: Q9NRE1, Q3MJ78, Q9GZS2, Q9NR87
Gene ID:
Human(56547) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The encoded protein degrades type IV collagen, fibronectin, fibrinogen, casein, vitronectin, alpha 1-antitrypsin, alpha 2-macroglobulin, and insulin-like growth factor-binding protein 1, and activates MMP9 by cleavage. The protein differs from most MMP family members in that it lacks a conserved C-terminal protein domain. [provided by RefSeq, Jul 2008]
dog(610101) matrix metallopeptidase 26
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021801 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050191 MISSION® esiRNA esiRNA human MMP26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021801 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139453 predicted 623
2 SASI_Hs01_00139454 predicted 298
3 SASI_Hs02_00355102 predicted 323
4 SASI_Hs01_00139457 predicted 211
5 SASI_Hs02_00355103 predicted 672
6 SASI_Hs01_00139460 predicted 736
7 SASI_Hs01_00139461 predicted 551
8 SASI_Hs02_00355104 predicted 627
9 SASI_Hs02_00355105 predicted 454
10 SASI_Hs01_00139462 predicted 754
11 SASI_Hs01_00139455 predicted 328
12 SASI_Hs01_00139456 predicted 449
13 SASI_Hs01_00139458 predicted 313
14 SASI_Hs01_00139459 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021801
MMP26 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 26
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-371s1c1
Sequence:CCGGCCGCAGTGAAAGACAGTATATCTCGAGATATACTGTCTTTCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-115s1c1
Sequence:CCGGGAGGGCTATTTCCATCAATTTCTCGAGAAATTGATGGAAATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-189s1c1
Sequence:CCGGCCTGCAACAATTCCATCGGAACTCGAGTTCCGATGGAATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-321s1c1
Sequence:CCGGGCACACTCTAACTTACAGGATCTCGAGATCCTGTAAGTTAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021801.3-785s21c1
Sequence:CCGGGTTCATCTGACATACCTTAATCTCGAGATTAAGGTATGTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021801.3-831s21c1
Sequence:CCGGTGTCCTTTCAGGGAGTTTATTCTCGAGAATAAACTCCCTGAAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021801
MMP26 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 26
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-371s1c1
Sequence:CCGGCCGCAGTGAAAGACAGTATATCTCGAGATATACTGTCTTTCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-115s1c1
Sequence:CCGGGAGGGCTATTTCCATCAATTTCTCGAGAAATTGATGGAAATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-189s1c1
Sequence:CCGGCCTGCAACAATTCCATCGGAACTCGAGTTCCGATGGAATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-321s1c1
Sequence:CCGGGCACACTCTAACTTACAGGATCTCGAGATCCTGTAAGTTAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021801.3-785s21c1
Sequence:CCGGGTTCATCTGACATACCTTAATCTCGAGATTAAGGTATGTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021801.3-831s21c1
Sequence:CCGGTGTCCTTTCAGGGAGTTTATTCTCGAGAATAAACTCCCTGAAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021801
MMP26 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 26
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-371s1c1
Sequence:CCGGCCGCAGTGAAAGACAGTATATCTCGAGATATACTGTCTTTCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-115s1c1
Sequence:CCGGGAGGGCTATTTCCATCAATTTCTCGAGAAATTGATGGAAATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-189s1c1
Sequence:CCGGCCTGCAACAATTCCATCGGAACTCGAGTTCCGATGGAATTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021801.2-321s1c1
Sequence:CCGGGCACACTCTAACTTACAGGATCTCGAGATCCTGTAAGTTAGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021801.3-785s21c1
Sequence:CCGGGTTCATCTGACATACCTTAATCTCGAGATTAAGGTATGTCAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021801.3-831s21c1
Sequence:CCGGTGTCCTTTCAGGGAGTTTATTCTCGAGAATAAACTCCCTGAAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks