EMAIL THIS PAGE TO A FRIEND

MON2

MON2 homolog (S. cerevisiae)

Gene ID:
Mouse(67074) MON2 homolog (yeast)
Rat(314894) MON2 homolog (S. cerevisiae)
Zebrafish(323992) MON2 homolog (S. cerevisiae)
fruit fly(326157) CG8683 gene product from transcript CG8683-RB
cow(782635) MON2 homolog (S. cerevisiae)
domestic cat(101085643) MON2 homolog (S. cerevisiae)
dog(481141) MON2 homolog (S. cerevisiae)
chicken(417818) MON2 homolog (S. cerevisiae)
sheep(101112385) MON2 homolog (S. cerevisiae)
naked mole-rat(101718757) MON2 homolog (S. cerevisiae)
domestic guinea pig(100715163) MON2 homolog (S. cerevisiae)
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015026 Rosetta Predictions human pricing
XM_001053843 Rosetta Predictions rat pricing
XM_001054316 Rosetta Predictions rat pricing
XM_001054664 Rosetta Predictions rat pricing
NM_153395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146498 predicted 4598
2 SASI_Hs01_00146499 predicted 4015
3 SASI_Hs02_00346823 predicted 642
4 SASI_Hs01_00146500 predicted 2523
5 SASI_Hs01_00146502 predicted 1528
6 SASI_Hs02_00346824 predicted 3596
7 SASI_Hs02_00346825 predicted 5430
8 SASI_Hs01_00146503 predicted 4502
9 SASI_Hs01_00146504 predicted 5409
10 SASI_Hs01_00146505 predicted 5420
11 SASI_Hs01_00146496 predicted 1010
12 SASI_Hs01_00146497 predicted 2677
13 SASI_Hs01_00146501 predicted 4301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273784 predicted 4331
2 SASI_Rn02_00273785 predicted 5049
3 SASI_Rn02_00273786 predicted 2562
4 SASI_Rn02_00273787 predicted 4405
5 SASI_Rn02_00273788 predicted 1215
6 SASI_Rn02_00273789 predicted 3185
7 SASI_Rn02_00273790 predicted 4160
8 SASI_Rn02_00273791 predicted 2287
9 SASI_Rn02_00273792 predicted 754
10 SASI_Rn02_00273793 predicted 5049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275437 predicted 4817
2 SASI_Rn02_00275438 predicted 5526
3 SASI_Rn02_00275439 predicted 3030
4 SASI_Rn02_00275440 predicted 4888
5 SASI_Rn02_00275441 predicted 1676
6 SASI_Rn02_00275442 predicted 3645
7 SASI_Rn02_00275443 predicted 4625
8 SASI_Rn02_00275444 predicted 2751
9 SASI_Rn02_00275445 predicted 1208
10 SASI_Rn02_00275446 predicted 5533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276707 predicted 4334
2 SASI_Rn02_00276708 predicted 5041
3 SASI_Rn02_00276709 predicted 2566
4 SASI_Rn02_00276710 predicted 4412
5 SASI_Rn02_00276711 predicted 1216
6 SASI_Rn02_00276712 predicted 3181
7 SASI_Rn02_00276713 predicted 4161
8 SASI_Rn02_00276714 predicted 2289
9 SASI_Rn02_00276715 predicted 749
10 SASI_Rn02_00276716 predicted 5049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088416 predicted 4735
2 SASI_Mm01_00088418 predicted 2292
3 SASI_Mm01_00088420 predicted 3242
4 SASI_Mm02_00343174 predicted 2323
5 SASI_Mm01_00088421 predicted 4244
6 SASI_Mm02_00343175 predicted 5014
7 SASI_Mm01_00088422 predicted 2933
8 SASI_Mm01_00088423 predicted 2144
9 SASI_Mm02_00343176 predicted 1215
10 SASI_Mm01_00088424 predicted 4164
11 SASI_Mm01_00088417 predicted 4120
12 SASI_Mm01_00088419 predicted 421
13 SASI_Mm01_00088425 predicted 1905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015026
VALIDATED
MON2 MISSION shRNA Bacterial Glycerol Stock
MON2 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5803s1c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-2991s1c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-1878s1c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5726s1c1
Sequence:CCGGCCTGAATGAACAGCAGTGTAACTCGAGTTACACTGCTGTTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5603s1c1
Sequence:CCGGGTCTTCTGTGAGAAGGACATTCTCGAGAATGTCCTTCTCACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5736s1c1
Sequence:CCGGCAGCAGTGTAAGGCTTTAATACTCGAGTATTAAAGCCTTACACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5561s1c1
Sequence:CCGGGAAAGCAGGAAGATAGTCTAACTCGAGTTAGACTATCTTCCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5370s1c1
Sequence:CCGGCCTGAGAATGTTGATGGAAATCTCGAGATTTCCATCAACATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015026.1-2233s1c1
Sequence:CCGGCCCATTATGCTCTTACTGTATCTCGAGATACAGTAAGAGCATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5056s1c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-1880s21c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5240s21c1
Sequence:CCGGGATGTACTACATCGCTATATACTCGAGTATATAGCGATGTAGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-2993s21c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015026.2-5058s21c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5805s21c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015026
VALIDATED
MON2 MISSION shRNA shRNA Plasmid DNA
MON2 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5803s1c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-2991s1c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-1878s1c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5726s1c1
Sequence:CCGGCCTGAATGAACAGCAGTGTAACTCGAGTTACACTGCTGTTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5603s1c1
Sequence:CCGGGTCTTCTGTGAGAAGGACATTCTCGAGAATGTCCTTCTCACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5736s1c1
Sequence:CCGGCAGCAGTGTAAGGCTTTAATACTCGAGTATTAAAGCCTTACACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5561s1c1
Sequence:CCGGGAAAGCAGGAAGATAGTCTAACTCGAGTTAGACTATCTTCCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5370s1c1
Sequence:CCGGCCTGAGAATGTTGATGGAAATCTCGAGATTTCCATCAACATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015026.1-2233s1c1
Sequence:CCGGCCCATTATGCTCTTACTGTATCTCGAGATACAGTAAGAGCATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5056s1c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-1880s21c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5240s21c1
Sequence:CCGGGATGTACTACATCGCTATATACTCGAGTATATAGCGATGTAGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-2993s21c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015026.2-5058s21c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5805s21c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015026
VALIDATED
MON2 MISSION shRNA Lentiviral Transduction Particles
MON2 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5803s1c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-2991s1c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-1878s1c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5726s1c1
Sequence:CCGGCCTGAATGAACAGCAGTGTAACTCGAGTTACACTGCTGTTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5603s1c1
Sequence:CCGGGTCTTCTGTGAGAAGGACATTCTCGAGAATGTCCTTCTCACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5736s1c1
Sequence:CCGGCAGCAGTGTAAGGCTTTAATACTCGAGTATTAAAGCCTTACACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015026.1-5561s1c1
Sequence:CCGGGAAAGCAGGAAGATAGTCTAACTCGAGTTAGACTATCTTCCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5370s1c1
Sequence:CCGGCCTGAGAATGTTGATGGAAATCTCGAGATTTCCATCAACATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015026.1-2233s1c1
Sequence:CCGGCCCATTATGCTCTTACTGTATCTCGAGATACAGTAAGAGCATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015026.1-5056s1c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-1880s21c1
Sequence:CCGGCGTGGAATCACAAGTATGATTCTCGAGAATCATACTTGTGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5240s21c1
Sequence:CCGGGATGTACTACATCGCTATATACTCGAGTATATAGCGATGTAGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-2993s21c1
Sequence:CCGGCCGTTAAAGGAGATGTCCAATCTCGAGATTGGACATCTCCTTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015026.2-5058s21c1
Sequence:CCGGGCTCAATACATTCTCAGTCATCTCGAGATGACTGAGAATGTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015026.2-5805s21c1
Sequence:CCGGCCATATCTCCAGTTGGTGATTCTCGAGAATCACCAACTGGAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153395
VALIDATED
MON2 MISSION shRNA Bacterial Glycerol Stock
MON2 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-4118s21c1
Sequence:CCGGGATCATGTACCCGGCTATATTCTCGAGAATATAGCCGGGTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-214s21c1
Sequence:CCGGCTGCAAGAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153395.1-5317s21c1
Sequence:CCGGTAATTATCTGGGTACAGTAATCTCGAGATTACTGTACCCAGATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-3240s21c1
Sequence:CCGGTCCACCTGGCACACCATTATTCTCGAGAATAATGGTGTGCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-2951s21c1
Sequence:CCGGCTTAACGTCAATAGGCTTATTCTCGAGAATAAGCCTATTGACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153395
VALIDATED
MON2 MISSION shRNA shRNA Plasmid DNA
MON2 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-4118s21c1
Sequence:CCGGGATCATGTACCCGGCTATATTCTCGAGAATATAGCCGGGTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-214s21c1
Sequence:CCGGCTGCAAGAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153395.1-5317s21c1
Sequence:CCGGTAATTATCTGGGTACAGTAATCTCGAGATTACTGTACCCAGATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-3240s21c1
Sequence:CCGGTCCACCTGGCACACCATTATTCTCGAGAATAATGGTGTGCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-2951s21c1
Sequence:CCGGCTTAACGTCAATAGGCTTATTCTCGAGAATAAGCCTATTGACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153395
VALIDATED
MON2 MISSION shRNA Lentiviral Transduction Particles
MON2 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-4118s21c1
Sequence:CCGGGATCATGTACCCGGCTATATTCTCGAGAATATAGCCGGGTACATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-214s21c1
Sequence:CCGGCTGCAAGAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153395.1-5317s21c1
Sequence:CCGGTAATTATCTGGGTACAGTAATCTCGAGATTACTGTACCCAGATAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153395.1-3240s21c1
Sequence:CCGGTCCACCTGGCACACCATTATTCTCGAGAATAATGGTGTGCCAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153395.1-2951s21c1
Sequence:CCGGCTTAACGTCAATAGGCTTATTCTCGAGAATAAGCCTATTGACGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks