EMAIL THIS PAGE TO A FRIEND

MORC2

MORC family CW-type zinc finger 2

Synonyms: ZCW3 ZCWCC1
UniProtKB ID: Q9Y6X9, B2RNB1, Q9UF28, Q9Y6V2
Gene ID:
Rat(289736) MORC family CW-type zinc finger 2
Zebrafish(445488) MORC family CW-type zinc finger 2
dog(486358) MORC family CW-type zinc finger 2
cow(504634) MORC family CW-type zinc finger 2
Horse(100063412) MORC family CW-type zinc finger 2
domestic cat(101094630) MORC family CW-type zinc finger 2
chicken(100858829) MORC family CW-type zinc finger 2
naked mole-rat(101724396) MORC family CW-type zinc finger 2
domestic guinea pig(100733360) MORC family CW-type zinc finger 2
sheep(101113533) MORC family CW-type zinc finger 2
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301687 Anti-MORC2 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
HPA000436 Anti-MORC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014941 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014481 MISSION® esiRNA esiRNA targeting human MORC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014941 Rosetta Predictions human pricing
NM_001106016 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097054 predicted 1834
2 SASI_Hs01_00097055 predicted 2561
3 SASI_Hs01_00097056 predicted 4020
4 SASI_Hs01_00097058 predicted 1718
5 SASI_Hs01_00097059 predicted 1660
6 SASI_Hs01_00097060 predicted 1683
7 SASI_Hs01_00097061 predicted 1808
8 SASI_Hs01_00097062 predicted 1456
9 SASI_Hs02_00346614 predicted 3656
10 SASI_Hs01_00097063 predicted 3931
11 SASI_Hs01_00097057 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214792 predicted 2693
2 SASI_Rn02_00214793 predicted 2340
3 SASI_Rn02_00214794 predicted 1857
4 SASI_Rn02_00214795 predicted 1716
5 SASI_Rn02_00214796 predicted 1665
6 SASI_Rn02_00214797 predicted 2642
7 SASI_Rn02_00214798 predicted 2971
8 SASI_Rn02_00214799 predicted 883
9 SASI_Rn02_00214800 predicted 2617
10 SASI_Rn02_00214801 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014941
VALIDATED
MORC2 MISSION shRNA Bacterial Glycerol Stock
MORC family CW-type zinc finger 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-2009s1c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-4019s1c1
Sequence:CCGGGAAGGAGTACTTCAAGCAATACTCGAGTATTGCTTGAAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-3399s1c1
Sequence:CCGGGCAGTTTCTGATGAGGAAGAACTCGAGTTCTTCCTCATCAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-2748s1c1
Sequence:CCGGGTTTGCTCCATGAACCCTGATCTCGAGATCAGGGTTCATGGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-2118s1c1
Sequence:CCGGCGGACATTAGAAGTACGCCTACTCGAGTAGGCGTACTTCTAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-1691s1c1
Sequence:CCGGCATCTATAAGTACTCTCCATTCTCGAGAATGGAGAGTACTTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-3923s1c1
Sequence:CCGGCCGGAATTGTTTACGGTACTTCTCGAGAAGTACCGTAAACAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-2661s21c1
Sequence:CCGGACCACCATCCAGTGCGATTTGCTCGAGCAAATCGCACTGGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2106s21c1
Sequence:CCGGGAGAGCAAAGCTCGGACATTACTCGAGTAATGTCCGAGCTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2009s21c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-1905s21c1
Sequence:CCGGTATGCCGCTGTGCTCTATATTCTCGAGAATATAGAGCACAGCGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-1472s21c1
Sequence:CCGGGCAGTACGGGAATGGGTTAAACTCGAGTTTAACCCATTCCCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014941
VALIDATED
MORC2 MISSION shRNA shRNA Plasmid DNA
MORC family CW-type zinc finger 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-2009s1c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-4019s1c1
Sequence:CCGGGAAGGAGTACTTCAAGCAATACTCGAGTATTGCTTGAAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-3399s1c1
Sequence:CCGGGCAGTTTCTGATGAGGAAGAACTCGAGTTCTTCCTCATCAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-2748s1c1
Sequence:CCGGGTTTGCTCCATGAACCCTGATCTCGAGATCAGGGTTCATGGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-2118s1c1
Sequence:CCGGCGGACATTAGAAGTACGCCTACTCGAGTAGGCGTACTTCTAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-1691s1c1
Sequence:CCGGCATCTATAAGTACTCTCCATTCTCGAGAATGGAGAGTACTTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-3923s1c1
Sequence:CCGGCCGGAATTGTTTACGGTACTTCTCGAGAAGTACCGTAAACAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-2661s21c1
Sequence:CCGGACCACCATCCAGTGCGATTTGCTCGAGCAAATCGCACTGGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2106s21c1
Sequence:CCGGGAGAGCAAAGCTCGGACATTACTCGAGTAATGTCCGAGCTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2009s21c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-1905s21c1
Sequence:CCGGTATGCCGCTGTGCTCTATATTCTCGAGAATATAGAGCACAGCGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-1472s21c1
Sequence:CCGGGCAGTACGGGAATGGGTTAAACTCGAGTTTAACCCATTCCCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014941
VALIDATED
MORC2 MISSION shRNA Lentiviral Transduction Particles
MORC family CW-type zinc finger 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-2009s1c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-4019s1c1
Sequence:CCGGGAAGGAGTACTTCAAGCAATACTCGAGTATTGCTTGAAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014941.1-3399s1c1
Sequence:CCGGGCAGTTTCTGATGAGGAAGAACTCGAGTTCTTCCTCATCAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-2748s1c1
Sequence:CCGGGTTTGCTCCATGAACCCTGATCTCGAGATCAGGGTTCATGGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-2118s1c1
Sequence:CCGGCGGACATTAGAAGTACGCCTACTCGAGTAGGCGTACTTCTAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014941.1-1691s1c1
Sequence:CCGGCATCTATAAGTACTCTCCATTCTCGAGAATGGAGAGTACTTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014941.1-3923s1c1
Sequence:CCGGCCGGAATTGTTTACGGTACTTCTCGAGAAGTACCGTAAACAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-2661s21c1
Sequence:CCGGACCACCATCCAGTGCGATTTGCTCGAGCAAATCGCACTGGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2106s21c1
Sequence:CCGGGAGAGCAAAGCTCGGACATTACTCGAGTAATGTCCGAGCTTTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-2009s21c1
Sequence:CCGGCAAGTACACGTCAAGCCGTTTCTCGAGAAACGGCTTGACGTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014941.1-1905s21c1
Sequence:CCGGTATGCCGCTGTGCTCTATATTCTCGAGAATATAGAGCACAGCGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014941.1-1472s21c1
Sequence:CCGGGCAGTACGGGAATGGGTTAAACTCGAGTTTAACCCATTCCCGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks