EMAIL THIS PAGE TO A FRIEND

MPL

myeloproliferative leukemia virus oncogene

Synonyms: C-MPL CD110 MPLV THCYT2 TPOR
UniProtKB ID: P40238, Q5JUZ0
Gene ID:
Human(4352) Summary: In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
Mouse(17480) myeloproliferative leukemia virus oncogene
Rat(366455) myeloproliferative leukemia virus oncogene
Zebrafish(445381) myeloproliferative leukemia virus oncogene
domestic cat(101097002) myeloproliferative leukemia virus oncogene
cow(528492) myeloproliferative leukemia virus oncogene
Horse(100066544) myeloproliferative leukemia virus oncogene
dog(610801) myeloproliferative leukemia virus oncogene
chicken(414804) myeloproliferative leukemia virus oncogene
sheep(101110279) myeloproliferative leukemia virus oncogene
Domestic Rabbit(100008643) myeloproliferative leukemia virus oncogene
naked mole-rat(101707597) myeloproliferative leukemia virus oncogene
domestic guinea pig(100718268) myeloproliferative leukemia virus oncogene
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C204 Calmagite indicator grade human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005373 Rosetta Predictions human pricing
XM_001072502 Rosetta Predictions rat pricing
XM_345572 Rosetta Predictions rat pricing
NM_001122949 Rosetta Predictions mouse pricing
NM_010823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056705 predicted 521
2 SASI_Hs01_00056706 predicted 1305
3 SASI_Hs01_00056707 predicted 372
4 SASI_Hs01_00056708 predicted 1589
5 SASI_Hs01_00056709 predicted 412
6 SASI_Hs01_00056710 predicted 1917
7 SASI_Hs01_00056711 predicted 220
8 SASI_Hs01_00056712 predicted 1905
9 SASI_Hs01_00056713 predicted 320
10 SASI_Hs01_00056714 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339453 predicted 1654
2 SASI_Rn02_00339454 predicted 1687
3 SASI_Rn02_00339455 predicted 1505
4 SASI_Rn02_00339456 predicted 1290
5 SASI_Rn02_00339457 predicted 1700
6 SASI_Rn02_00339458 predicted 481
7 SASI_Rn02_00339459 predicted 489
8 SASI_Rn02_00339460 predicted 1297
9 SASI_Rn02_00339461 predicted 1584
10 SASI_Rn02_00339462 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398510 predicted 1274
2 SASI_Rn02_00398511 predicted 477
3 SASI_Rn02_00398512 predicted 494
4 SASI_Rn02_00398513 predicted 634
5 SASI_Rn02_00398514 predicted 339
6 SASI_Rn02_00398515 predicted 561
7 SASI_Rn02_00398516 predicted 486
8 SASI_Rn02_00398517 predicted 604
9 SASI_Rn02_00398518 predicted 496
10 SASI_Rn02_00398519 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309609 predicted 942
2 SASI_Mm02_00309610 predicted 1678
3 SASI_Mm02_00309611 predicted 1730
4 SASI_Mm02_00309612 predicted 1307
5 SASI_Mm02_00309613 predicted 1084
6 SASI_Mm02_00309614 predicted 304
7 SASI_Mm02_00309615 predicted 1067
8 SASI_Mm02_00309616 predicted 1498
9 SASI_Mm02_00309617 predicted 1630
10 SASI_Mm02_00309618 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319436 predicted 912
2 SASI_Mm02_00319437 predicted 1654
3 SASI_Mm02_00319438 predicted 1707
4 SASI_Mm02_00319439 predicted 1291
5 SASI_Mm01_00023942 predicted 1059
6 SASI_Mm01_00023943 predicted 301
7 SASI_Mm02_00319440 predicted 1049
8 SASI_Mm02_00319441 predicted 1483
9 SASI_Mm02_00319442 predicted 1599
10 SASI_Mm02_00319443 predicted 1638
11 SASI_Mm01_00023939 predicted 1688
12 SASI_Mm01_00023940 predicted 833
13 SASI_Mm01_00023941 predicted 482
14 SASI_Mm01_00023944 predicted 834
15 SASI_Mm01_00023945 predicted 1048
16 SASI_Mm01_00023946 predicted 1514
17 SASI_Mm01_00023947 predicted 846
18 SASI_Mm01_00023948 predicted 1619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005373
MPL MISSION shRNA Bacterial Glycerol Stock
myeloproliferative leukemia virus oncogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005373.2-1920s21c1
Sequence:CCGGCTACCTACCACTAAGCTATTGCTCGAGCAATAGCTTAGTGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2339s21c1
Sequence:CCGGATCCAATAGGATCTCGTTAATCTCGAGATTAACGAGATCCTATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2438s21c1
Sequence:CCGGTCCTGCCTCTTTGAGTATATTCTCGAGAATATACTCAAAGAGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1297s1c1
Sequence:CCGGGCCCAAGAGACCTGTTATCAACTCGAGTTGATAACAGGTCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-159s1c1
Sequence:CCGGGAAGTGTTTCTCCCGAACATTCTCGAGAATGTTCGGGAGAAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1110s1c1
Sequence:CCGGGTCACGAAATGACAGCATTATCTCGAGATAATGCTGTCATTTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-369s1c1
Sequence:CCGGCCTCTGGGTGAAGAATGTGTTCTCGAGAACACATTCTTCACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1919s1c1
Sequence:CCGGCCTACCTACCACTAAGCTATTCTCGAGAATAGCTTAGTGGTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005373
MPL MISSION shRNA shRNA Plasmid DNA
myeloproliferative leukemia virus oncogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005373.2-1920s21c1
Sequence:CCGGCTACCTACCACTAAGCTATTGCTCGAGCAATAGCTTAGTGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2339s21c1
Sequence:CCGGATCCAATAGGATCTCGTTAATCTCGAGATTAACGAGATCCTATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2438s21c1
Sequence:CCGGTCCTGCCTCTTTGAGTATATTCTCGAGAATATACTCAAAGAGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1297s1c1
Sequence:CCGGGCCCAAGAGACCTGTTATCAACTCGAGTTGATAACAGGTCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-159s1c1
Sequence:CCGGGAAGTGTTTCTCCCGAACATTCTCGAGAATGTTCGGGAGAAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1110s1c1
Sequence:CCGGGTCACGAAATGACAGCATTATCTCGAGATAATGCTGTCATTTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-369s1c1
Sequence:CCGGCCTCTGGGTGAAGAATGTGTTCTCGAGAACACATTCTTCACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1919s1c1
Sequence:CCGGCCTACCTACCACTAAGCTATTCTCGAGAATAGCTTAGTGGTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005373
MPL MISSION shRNA Lentiviral Transduction Particles
myeloproliferative leukemia virus oncogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005373.2-1920s21c1
Sequence:CCGGCTACCTACCACTAAGCTATTGCTCGAGCAATAGCTTAGTGGTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2339s21c1
Sequence:CCGGATCCAATAGGATCTCGTTAATCTCGAGATTAACGAGATCCTATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005373.2-2438s21c1
Sequence:CCGGTCCTGCCTCTTTGAGTATATTCTCGAGAATATACTCAAAGAGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1297s1c1
Sequence:CCGGGCCCAAGAGACCTGTTATCAACTCGAGTTGATAACAGGTCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-159s1c1
Sequence:CCGGGAAGTGTTTCTCCCGAACATTCTCGAGAATGTTCGGGAGAAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1110s1c1
Sequence:CCGGGTCACGAAATGACAGCATTATCTCGAGATAATGCTGTCATTTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-369s1c1
Sequence:CCGGCCTCTGGGTGAAGAATGTGTTCTCGAGAACACATTCTTCACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005373.1-1919s1c1
Sequence:CCGGCCTACCTACCACTAAGCTATTCTCGAGAATAGCTTAGTGGTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010823
MPL MISSION shRNA Bacterial Glycerol Stock
myeloproliferative leukemia virus oncogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1645s1c1
Sequence:CCGGGATAGCTGTGAAGAAGTGGAACTCGAGTTCCACTTCTTCACAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1051s1c1
Sequence:CCGGAGTGTTATTCACATCCTTGTACTCGAGTACAAGGATGTGAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-46s1c1
Sequence:CCGGGCCCTTCCAAACCAGGCACAACTCGAGTTGTGCCTGGTTTGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-471s1c1
Sequence:CCGGTGCTCCTGAAATCAGTGACTTCTCGAGAAGTCACTGATTTCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1504s1c1
Sequence:CCGGCTGCTGCTAAAGTGGCAATTTCTCGAGAAATTGCCACTTTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010823
MPL MISSION shRNA shRNA Plasmid DNA
myeloproliferative leukemia virus oncogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1645s1c1
Sequence:CCGGGATAGCTGTGAAGAAGTGGAACTCGAGTTCCACTTCTTCACAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1051s1c1
Sequence:CCGGAGTGTTATTCACATCCTTGTACTCGAGTACAAGGATGTGAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-46s1c1
Sequence:CCGGGCCCTTCCAAACCAGGCACAACTCGAGTTGTGCCTGGTTTGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-471s1c1
Sequence:CCGGTGCTCCTGAAATCAGTGACTTCTCGAGAAGTCACTGATTTCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1504s1c1
Sequence:CCGGCTGCTGCTAAAGTGGCAATTTCTCGAGAAATTGCCACTTTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010823
MPL MISSION shRNA Lentiviral Transduction Particles
myeloproliferative leukemia virus oncogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1645s1c1
Sequence:CCGGGATAGCTGTGAAGAAGTGGAACTCGAGTTCCACTTCTTCACAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1051s1c1
Sequence:CCGGAGTGTTATTCACATCCTTGTACTCGAGTACAAGGATGTGAATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-46s1c1
Sequence:CCGGGCCCTTCCAAACCAGGCACAACTCGAGTTGTGCCTGGTTTGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-471s1c1
Sequence:CCGGTGCTCCTGAAATCAGTGACTTCTCGAGAAGTCACTGATTTCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010823.1-1504s1c1
Sequence:CCGGCTGCTGCTAAAGTGGCAATTTCTCGAGAAATTGCCACTTTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks