EMAIL THIS PAGE TO A FRIEND

MPTX1

mucosal pentraxin 1 (pseudogene)

Synonyms: MPTX
UniProtKB ID: A8MV57
Gene ID:
Mouse(66289) mucosal pentraxin 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131442 Rosetta Predictions human pricing
XM_001722685 Rosetta Predictions human pricing
XM_938536 Rosetta Predictions human pricing
NM_025470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388320 predicted 457
2 SASI_Hs02_00388321 predicted 271
3 SASI_Hs02_00388322 predicted 373
4 SASI_Hs02_00388323 predicted 330
5 SASI_Hs02_00388324 predicted 200
6 SASI_Hs02_00388325 predicted 280
7 SASI_Hs02_00388326 predicted 384
8 SASI_Hs02_00388327 predicted 347
9 SASI_Hs02_00388328 predicted 205
10 SASI_Hs02_00388329 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00450685 predicted 301
2 SASI_Hs02_00450686 predicted 277
3 SASI_Hs02_00450687 predicted 378
4 SASI_Hs02_00450688 predicted 335
5 SASI_Hs02_00450689 predicted 201
6 SASI_Hs02_00450690 predicted 384
7 SASI_Hs02_00450691 predicted 348
8 SASI_Hs02_00450692 predicted 212
9 SASI_Hs02_00450693 predicted 291
10 SASI_Hs02_00450694 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483164 predicted 295
2 SASI_Hs02_00483165 predicted 276
3 SASI_Hs02_00483166 predicted 377
4 SASI_Hs02_00483167 predicted 338
5 SASI_Hs02_00483168 predicted 197
6 SASI_Hs02_00483169 predicted 389
7 SASI_Hs02_00483170 predicted 340
8 SASI_Hs02_00483171 predicted 211
9 SASI_Hs02_00483172 predicted 291
10 SASI_Hs02_00483173 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194994 predicted 383
2 SASI_Mm02_00328328 predicted 317
3 SASI_Mm02_00328329 predicted 212
4 SASI_Mm01_00194985 predicted 336
5 SASI_Mm01_00194986 predicted 484
6 SASI_Mm02_00328330 predicted 316
7 SASI_Mm02_00328331 predicted 238
8 SASI_Mm02_00328332 predicted 205
9 SASI_Mm01_00194987 predicted 461
10 SASI_Mm01_00194989 predicted 232
11 SASI_Mm01_00194988 predicted 229
12 SASI_Mm01_00194990 predicted 497
13 SASI_Mm01_00194991 predicted 336
14 SASI_Mm01_00194992 predicted 463
15 SASI_Mm01_00194993 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025470
MPTX1 MISSION shRNA Bacterial Glycerol Stock
mucosal pentraxin 1 (pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-202s1c1
Sequence:CCGGGCAGAACTTCACTCTGTGTATCTCGAGATACACAGAGTGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-268s1c1
Sequence:CCGGCAACACAAGAAACCAGGACAACTCGAGTTGTCCTGGTTTCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-627s1c1
Sequence:CCGGGCTGTAACAATGGCAACCTTACTCGAGTAAGGTTGCCATTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-351s1c1
Sequence:CCGGCCACTTTCAAAGCACCCACAACTCGAGTTGTGGGTGCTTTGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-259s1c1
Sequence:CCGGCTTCTCCTACAACACAAGAAACTCGAGTTTCTTGTGTTGTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025470
MPTX1 MISSION shRNA shRNA Plasmid DNA
mucosal pentraxin 1 (pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-202s1c1
Sequence:CCGGGCAGAACTTCACTCTGTGTATCTCGAGATACACAGAGTGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-268s1c1
Sequence:CCGGCAACACAAGAAACCAGGACAACTCGAGTTGTCCTGGTTTCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-627s1c1
Sequence:CCGGGCTGTAACAATGGCAACCTTACTCGAGTAAGGTTGCCATTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-351s1c1
Sequence:CCGGCCACTTTCAAAGCACCCACAACTCGAGTTGTGGGTGCTTTGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-259s1c1
Sequence:CCGGCTTCTCCTACAACACAAGAAACTCGAGTTTCTTGTGTTGTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025470
MPTX1 MISSION shRNA Lentiviral Transduction Particles
mucosal pentraxin 1 (pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-202s1c1
Sequence:CCGGGCAGAACTTCACTCTGTGTATCTCGAGATACACAGAGTGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-268s1c1
Sequence:CCGGCAACACAAGAAACCAGGACAACTCGAGTTGTCCTGGTTTCTTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-627s1c1
Sequence:CCGGGCTGTAACAATGGCAACCTTACTCGAGTAAGGTTGCCATTGTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-351s1c1
Sequence:CCGGCCACTTTCAAAGCACCCACAACTCGAGTTGTGGGTGCTTTGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025470.1-259s1c1
Sequence:CCGGCTTCTCCTACAACACAAGAAACTCGAGTTTCTTGTGTTGTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks