EMAIL THIS PAGE TO A FRIEND

MPZL2

myelin protein zero-like 2

Synonyms: EVA EVA1
UniProtKB ID: O60487, A8K2R1
Gene ID:
Human(10205) Summary: Thymus development depends on a complex series of interactions between thymocytes and the stromal component of the organ. Epithelial V-like antigen (EVA) is expressed in thymus epithelium and strongly downregulated by thymocyte developmental progression. This gene is expressed in the thymus and in several epithelial structures early in embryogenesis. It is highly homologous to the myelin protein zero and, in thymus-derived epithelial cell lines, is poorly soluble in nonionic detergents, strongly suggesting an association to the cytoskeleton. Its capacity to mediate cell adhesion through a homophilic interaction and its selective regulation by T cell maturation might imply the participation of EVA in the earliest phases of thymus organogenesis. The protein bears a characteristic V-type domain and two potential N-glycosylation sites in the extracellular domain; a putative serine phosphorylation site for casein kinase 2 is also present in the cytoplasmic tail. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14012) myelin protein zero-like 2
Rat(300679) myelin protein zero-like 2
chicken(419779) myelin protein zero-like 2
domestic cat(101089039) myelin protein zero-like 2
cow(540423) myelin protein zero-like 2
dog(489384) myelin protein zero-like 2
sheep(101122302) myelin protein zero-like 2
naked mole-rat(101711086) myelin protein zero-like 2
domestic guinea pig(100728058) myelin protein zero-like 2
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022971 MISSION® esiRNA esiRNA human MPZL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005797 Rosetta Predictions human pricing
NM_144765 Rosetta Predictions human pricing
NM_001106818 Rosetta Predictions rat pricing
NM_007962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121587 predicted 390
2 SASI_Hs02_00340300 predicted 413
3 SASI_Hs01_00121588 predicted 299
4 SASI_Hs01_00121589 predicted 393
5 SASI_Hs01_00121590 predicted 482
6 SASI_Hs01_00121591 predicted 402
7 SASI_Hs01_00121592 predicted 202
8 SASI_Hs01_00121593 predicted 517
9 SASI_Hs02_00340301 predicted 303
10 SASI_Hs01_00121594 predicted 199
11 SASI_Hs01_00121595 predicted 570
12 SASI_Hs01_00121596 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062025 predicted 396
2 SASI_Hs02_00364704 predicted 422
3 SASI_Hs01_00062026 predicted 305
4 SASI_Hs01_00062027 predicted 393
5 SASI_Hs01_00062028 predicted 475
6 SASI_Hs01_00062029 predicted 403
7 SASI_Hs01_00062030 predicted 205
8 SASI_Hs01_00062031 predicted 518
9 SASI_Hs02_00364705 predicted 308
10 SASI_Hs01_00062032 predicted 202
11 SASI_Hs01_00062033 predicted 576
12 SASI_Hs01_00062034 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222708 predicted 499
2 SASI_Rn02_00222709 predicted 748
3 SASI_Rn02_00222710 predicted 438
4 SASI_Rn02_00222711 predicted 880
5 SASI_Rn02_00222712 predicted 461
6 SASI_Rn02_00222713 predicted 1004
7 SASI_Rn02_00222714 predicted 1249
8 SASI_Rn02_00222715 predicted 1313
9 SASI_Rn02_00222716 predicted 915
10 SASI_Rn02_00222717 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073056 predicted 747
2 SASI_Mm01_00073057 predicted 1250
3 SASI_Mm01_00073059 predicted 560
4 SASI_Mm01_00073060 predicted 1267
5 SASI_Mm01_00073061 predicted 1029
6 SASI_Mm01_00073062 predicted 875
7 SASI_Mm01_00073063 predicted 1000
8 SASI_Mm01_00073064 predicted 1191
9 SASI_Mm01_00073065 predicted 770
10 SASI_Mm02_00312847 predicted 1351
11 SASI_Mm01_00073058 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005797
MPZL2 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1138s21c1
Sequence:CCGGACCAGTTCTGCAGCATATTAGCTCGAGCTAATATGCTGCAGAACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1063s21c1
Sequence:CCGGAGAACAAGAACCCTAGTATTTCTCGAGAAATACTAGGGTTCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005797.3-638s21c1
Sequence:CCGGACCCATGAGTGGGCGGTTTAACTCGAGTTAAACCGCCCACTCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1224s21c1
Sequence:CCGGGCCTCATTATTAAGGTCTTATCTCGAGATAAGACCTTAATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-474s1c1
Sequence:CCGGGAAACTGCAGTTCGACGACAACTCGAGTTGTCGTCGAACTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-185s1c1
Sequence:CCGGGCATACAGCTCACAGCTCTTTCTCGAGAAAGAGCTGTGAGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005797.2-730s1c1
Sequence:CCGGGAAGAGGAAAGGCTCAACCAACTCGAGTTGGTTGAGCCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-483s1c1
Sequence:CCGGGTTCGACGACAATGGGACATACTCGAGTATGTCCCATTGTCGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1179s1c1
Sequence:CCGGGCACTTCTGCTACTAAAGTTACTCGAGTAACTTTAGTAGCAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1217s1c1
Sequence:CCGGCCTTCCCACATTCTCAATTAACTCGAGTTAATTGAGAATGTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005797
MPZL2 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1138s21c1
Sequence:CCGGACCAGTTCTGCAGCATATTAGCTCGAGCTAATATGCTGCAGAACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1063s21c1
Sequence:CCGGAGAACAAGAACCCTAGTATTTCTCGAGAAATACTAGGGTTCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005797.3-638s21c1
Sequence:CCGGACCCATGAGTGGGCGGTTTAACTCGAGTTAAACCGCCCACTCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1224s21c1
Sequence:CCGGGCCTCATTATTAAGGTCTTATCTCGAGATAAGACCTTAATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-474s1c1
Sequence:CCGGGAAACTGCAGTTCGACGACAACTCGAGTTGTCGTCGAACTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-185s1c1
Sequence:CCGGGCATACAGCTCACAGCTCTTTCTCGAGAAAGAGCTGTGAGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005797.2-730s1c1
Sequence:CCGGGAAGAGGAAAGGCTCAACCAACTCGAGTTGGTTGAGCCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-483s1c1
Sequence:CCGGGTTCGACGACAATGGGACATACTCGAGTATGTCCCATTGTCGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1179s1c1
Sequence:CCGGGCACTTCTGCTACTAAAGTTACTCGAGTAACTTTAGTAGCAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1217s1c1
Sequence:CCGGCCTTCCCACATTCTCAATTAACTCGAGTTAATTGAGAATGTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005797
MPZL2 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1138s21c1
Sequence:CCGGACCAGTTCTGCAGCATATTAGCTCGAGCTAATATGCTGCAGAACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1063s21c1
Sequence:CCGGAGAACAAGAACCCTAGTATTTCTCGAGAAATACTAGGGTTCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005797.3-638s21c1
Sequence:CCGGACCCATGAGTGGGCGGTTTAACTCGAGTTAAACCGCCCACTCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005797.3-1224s21c1
Sequence:CCGGGCCTCATTATTAAGGTCTTATCTCGAGATAAGACCTTAATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-474s1c1
Sequence:CCGGGAAACTGCAGTTCGACGACAACTCGAGTTGTCGTCGAACTGCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-185s1c1
Sequence:CCGGGCATACAGCTCACAGCTCTTTCTCGAGAAAGAGCTGTGAGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005797.2-730s1c1
Sequence:CCGGGAAGAGGAAAGGCTCAACCAACTCGAGTTGGTTGAGCCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005797.2-483s1c1
Sequence:CCGGGTTCGACGACAATGGGACATACTCGAGTATGTCCCATTGTCGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1179s1c1
Sequence:CCGGGCACTTCTGCTACTAAAGTTACTCGAGTAACTTTAGTAGCAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005797.2-1217s1c1
Sequence:CCGGCCTTCCCACATTCTCAATTAACTCGAGTTAATTGAGAATGTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007962
MPZL2 MISSION shRNA Bacterial Glycerol Stock
myelin protein zero-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-589s1c1
Sequence:CCGGCAGGTGAAGAATCCACCTGATCTCGAGATCAGGTGGATTCTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-393s1c1
Sequence:CCGGGCTAACTGTGACGTGGAATTTCTCGAGAAATTCCACGTCACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-391s1c1
Sequence:CCGGGCGCTAACTGTGACGTGGAATCTCGAGATTCCACGTCACAGTTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-336s1c1
Sequence:CCGGCGGGACAGATGTTCGGTTAAACTCGAGTTTAACCGAACATCTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007962.2-1624s1c1
Sequence:CCGGGCGCAAATCTAAGCACAATAACTCGAGTTATTGTGCTTAGATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007962
MPZL2 MISSION shRNA shRNA Plasmid DNA
myelin protein zero-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-589s1c1
Sequence:CCGGCAGGTGAAGAATCCACCTGATCTCGAGATCAGGTGGATTCTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-393s1c1
Sequence:CCGGGCTAACTGTGACGTGGAATTTCTCGAGAAATTCCACGTCACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-391s1c1
Sequence:CCGGGCGCTAACTGTGACGTGGAATCTCGAGATTCCACGTCACAGTTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-336s1c1
Sequence:CCGGCGGGACAGATGTTCGGTTAAACTCGAGTTTAACCGAACATCTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007962.2-1624s1c1
Sequence:CCGGGCGCAAATCTAAGCACAATAACTCGAGTTATTGTGCTTAGATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007962
MPZL2 MISSION shRNA Lentiviral Transduction Particles
myelin protein zero-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-589s1c1
Sequence:CCGGCAGGTGAAGAATCCACCTGATCTCGAGATCAGGTGGATTCTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-393s1c1
Sequence:CCGGGCTAACTGTGACGTGGAATTTCTCGAGAAATTCCACGTCACAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-391s1c1
Sequence:CCGGGCGCTAACTGTGACGTGGAATCTCGAGATTCCACGTCACAGTTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007962.2-336s1c1
Sequence:CCGGCGGGACAGATGTTCGGTTAAACTCGAGTTTAACCGAACATCTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007962.2-1624s1c1
Sequence:CCGGGCGCAAATCTAAGCACAATAACTCGAGTTATTGTGCTTAGATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks