EMAIL THIS PAGE TO A FRIEND

MRGPRE

MAS-related GPR, member E

Synonyms: GPR167 MRGE
UniProtKB ID: Q86SM8, Q2M1V7
Gene ID:
Mouse(244238) MAS-related GPR, member E
Rat(404660) MAS-related GPR, member E
naked mole-rat(101702082) MAS-related GPR, member E
domestic guinea pig(100718390) MAS-related GPR, member E
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039165 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039165 Rosetta Predictions human pricing
NM_001002288 Rosetta Predictions rat pricing
NM_175534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198639 predicted 598
2 SASI_Hs01_00198640 predicted 481
3 SASI_Hs01_00198641 predicted 605
4 SASI_Hs01_00198642 predicted 607
5 SASI_Hs02_00308441 predicted 376
6 SASI_Hs01_00198643 predicted 674
7 SASI_Hs01_00198644 predicted 87
8 SASI_Hs01_00198645 predicted 86
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079967 predicted 276
2 SASI_Rn02_00197977 predicted 682
3 SASI_Rn01_00079968 predicted 679
4 SASI_Rn01_00079969 predicted 484
5 SASI_Rn01_00079971 predicted 238
6 SASI_Rn01_00079972 predicted 410
7 SASI_Rn01_00079973 predicted 251
8 SASI_Rn01_00079974 predicted 391
9 SASI_Rn02_00197978 predicted 208
10 SASI_Rn01_00079976 predicted 552
11 SASI_Rn01_00079970 predicted 275
12 SASI_Rn01_00079975 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146684 predicted 1087
2 SASI_Mm01_00146685 predicted 1177
3 SASI_Mm01_00146687 predicted 223
4 SASI_Mm01_00146688 predicted 672
5 SASI_Mm01_00146689 predicted 331
6 SASI_Mm01_00146690 predicted 1457
7 SASI_Mm01_00146691 predicted 669
8 SASI_Mm01_00146692 predicted 1510
9 SASI_Mm01_00146693 predicted 451
10 SASI_Mm02_00346487 predicted 329
11 SASI_Mm01_00146686 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175534
MRGPRE MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175534.2-2131s1c1
Sequence:CCGGCCTCATCCAATGTTTCAGAAACTCGAGTTTCTGAAACATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-469s1c1
Sequence:CCGGCTGCGGTTCTTCTGCTACATTCTCGAGAATGTAGCAGAAGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-471s1c1
Sequence:CCGGGCGGTTCTTCTGCTACATTGTCTCGAGACAATGTAGCAGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-216s1c1
Sequence:CCGGCCAGGGAGAAATGGCTTTCAACTCGAGTTGAAAGCCATTTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-915s1c1
Sequence:CCGGCTATCATTTCAGCTTCTTCATCTCGAGATGAAGAAGCTGAAATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175534
MRGPRE MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175534.2-2131s1c1
Sequence:CCGGCCTCATCCAATGTTTCAGAAACTCGAGTTTCTGAAACATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-469s1c1
Sequence:CCGGCTGCGGTTCTTCTGCTACATTCTCGAGAATGTAGCAGAAGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-471s1c1
Sequence:CCGGGCGGTTCTTCTGCTACATTGTCTCGAGACAATGTAGCAGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-216s1c1
Sequence:CCGGCCAGGGAGAAATGGCTTTCAACTCGAGTTGAAAGCCATTTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-915s1c1
Sequence:CCGGCTATCATTTCAGCTTCTTCATCTCGAGATGAAGAAGCTGAAATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175534
MRGPRE MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175534.2-2131s1c1
Sequence:CCGGCCTCATCCAATGTTTCAGAAACTCGAGTTTCTGAAACATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-469s1c1
Sequence:CCGGCTGCGGTTCTTCTGCTACATTCTCGAGAATGTAGCAGAAGAACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-471s1c1
Sequence:CCGGGCGGTTCTTCTGCTACATTGTCTCGAGACAATGTAGCAGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-216s1c1
Sequence:CCGGCCAGGGAGAAATGGCTTTCAACTCGAGTTGAAAGCCATTTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175534.2-915s1c1
Sequence:CCGGCTATCATTTCAGCTTCTTCATCTCGAGATGAAGAAGCTGAAATGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039165
MRGPRE MISSION shRNA Bacterial Glycerol Stock
MAS-related GPR, member E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-448s21c1
Sequence:CCGGGCTGCTCAGCTCCAATGTCTACTCGAGTAGACATTGGAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-372s21c1
Sequence:CCGGCCTTCAACCTCATCATCCTGTCTCGAGACAGGATGATGAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-864s21c1
Sequence:CCGGCTCTGCTGTGTTGCACCATGTCTCGAGACATGGTGCAACACAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-611s21c1
Sequence:CCGGCTGCGCTTCTTCTGCTACATCCTCGAGGATGTAGCAGAAGAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-506s21c1
Sequence:CCGGTGCGCGGATCTCATCTTCCTTCTCGAGAAGGAAGATGAGATCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039165
MRGPRE MISSION shRNA shRNA Plasmid DNA
MAS-related GPR, member E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-448s21c1
Sequence:CCGGGCTGCTCAGCTCCAATGTCTACTCGAGTAGACATTGGAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-372s21c1
Sequence:CCGGCCTTCAACCTCATCATCCTGTCTCGAGACAGGATGATGAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-864s21c1
Sequence:CCGGCTCTGCTGTGTTGCACCATGTCTCGAGACATGGTGCAACACAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-611s21c1
Sequence:CCGGCTGCGCTTCTTCTGCTACATCCTCGAGGATGTAGCAGAAGAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-506s21c1
Sequence:CCGGTGCGCGGATCTCATCTTCCTTCTCGAGAAGGAAGATGAGATCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039165
MRGPRE MISSION shRNA Lentiviral Transduction Particles
MAS-related GPR, member E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-448s21c1
Sequence:CCGGGCTGCTCAGCTCCAATGTCTACTCGAGTAGACATTGGAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-372s21c1
Sequence:CCGGCCTTCAACCTCATCATCCTGTCTCGAGACAGGATGATGAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-864s21c1
Sequence:CCGGCTCTGCTGTGTTGCACCATGTCTCGAGACATGGTGCAACACAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-611s21c1
Sequence:CCGGCTGCGCTTCTTCTGCTACATCCTCGAGGATGTAGCAGAAGAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039165.2-506s21c1
Sequence:CCGGTGCGCGGATCTCATCTTCCTTCTCGAGAAGGAAGATGAGATCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks