EMAIL THIS PAGE TO A FRIEND

MROH9

maestro heat-like repeat family member 9

Synonyms: ARMC11 C1orf129
UniProtKB ID: Q5TGP6, A0PJM0, A0PJM2, F5GWX6, Q9H5D7
Gene ID:
Mouse(78258) maestro heat-like repeat family member 9
Rat(501864) maestro heat-like repeat family member 9
naked mole-rat(101699428) maestro heat-like repeat family member 9
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135721 MISSION® esiRNA esiRNA human C1orf129 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025063 Rosetta Predictions human pricing
XM_577279 Rosetta Predictions rat pricing
XM_001479548 Rosetta Predictions mouse pricing
XM_136353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029890 predicted 1558
2 SASI_Hs01_00029891 predicted 477
3 SASI_Hs01_00029892 predicted 388
4 SASI_Hs02_00357726 predicted 781
5 SASI_Hs01_00029893 predicted 356
6 SASI_Hs02_00357727 predicted 1799
7 SASI_Hs01_00029896 predicted 910
8 SASI_Hs01_00029897 predicted 301
9 SASI_Hs01_00029899 predicted 451
10 SASI_Hs02_00357728 predicted 1844
11 SASI_Hs01_00029894 predicted 578
12 SASI_Hs01_00029895 predicted 250
13 SASI_Hs01_00029898 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180174 predicted 1426
2 SASI_Rn01_00180175 predicted 859
3 SASI_Rn01_00180176 predicted 631
4 SASI_Rn01_00180177 predicted 708
5 SASI_Rn01_00180178 predicted 2313
6 SASI_Rn01_00180179 predicted 1304
7 SASI_Rn01_00180180 predicted 1681
8 SASI_Rn01_00180181 predicted 1115
9 SASI_Rn01_00180182 predicted 2501
10 SASI_Rn01_00180183 predicted 2382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410822 predicted 616
2 SASI_Mm02_00410823 predicted 2417
3 SASI_Mm02_00410824 predicted 1379
4 SASI_Mm02_00410825 predicted 955
5 SASI_Mm02_00410826 predicted 245
6 SASI_Mm02_00410827 predicted 2208
7 SASI_Mm02_00410828 predicted 2713
8 SASI_Mm02_00410829 predicted 1500
9 SASI_Mm02_00410830 predicted 1511
10 SASI_Mm02_00410831 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218265 predicted 616
2 SASI_Mm01_00218266 predicted 1381
3 SASI_Mm01_00218268 predicted 957
4 SASI_Mm01_00218269 predicted 240
5 SASI_Mm01_00218270 predicted 1820
6 SASI_Mm01_00218271 predicted 1498
7 SASI_Mm01_00218272 predicted 1513
8 SASI_Mm01_00218273 predicted 318
9 SASI_Mm01_00218274 predicted 1096
10 SASI_Mm02_00424726 predicted 2039
11 SASI_Mm01_00218267 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030071
MROH9 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2726s21c1
Sequence:CCGGAGTCTGATAGAGTCCAATTTACTCGAGTAAATTGGACTCTATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-623s21c1
Sequence:CCGGAGTATCGATGCTCCGTGTTTACTCGAGTAAACACGGAGCATCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-570s21c1
Sequence:CCGGTGGTTATCACCAGGGTATTAACTCGAGTTAATACCCTGGTGATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-1969s21c1
Sequence:CCGGCATGCTTACCCTTCGAAATATCTCGAGATATTTCGAAGGGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2690s21c1
Sequence:CCGGACCCTCGAAGGGAACGAAATACTCGAGTATTTCGTTCCCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030071
MROH9 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2726s21c1
Sequence:CCGGAGTCTGATAGAGTCCAATTTACTCGAGTAAATTGGACTCTATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-623s21c1
Sequence:CCGGAGTATCGATGCTCCGTGTTTACTCGAGTAAACACGGAGCATCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-570s21c1
Sequence:CCGGTGGTTATCACCAGGGTATTAACTCGAGTTAATACCCTGGTGATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-1969s21c1
Sequence:CCGGCATGCTTACCCTTCGAAATATCTCGAGATATTTCGAAGGGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2690s21c1
Sequence:CCGGACCCTCGAAGGGAACGAAATACTCGAGTATTTCGTTCCCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030071
MROH9 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2726s21c1
Sequence:CCGGAGTCTGATAGAGTCCAATTTACTCGAGTAAATTGGACTCTATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-623s21c1
Sequence:CCGGAGTATCGATGCTCCGTGTTTACTCGAGTAAACACGGAGCATCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-570s21c1
Sequence:CCGGTGGTTATCACCAGGGTATTAACTCGAGTTAATACCCTGGTGATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-1969s21c1
Sequence:CCGGCATGCTTACCCTTCGAAATATCTCGAGATATTTCGAAGGGTAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030071.1-2690s21c1
Sequence:CCGGACCCTCGAAGGGAACGAAATACTCGAGTATTTCGTTCCCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025063
MROH9 MISSION shRNA Bacterial Glycerol Stock
maestro heat-like repeat family member 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1658s1c1
Sequence:CCGGCAGAAGACACTGTCATCGTATCTCGAGATACGATGACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-149s1c1
Sequence:CCGGCAGTGTGAAATGGCACCACATCTCGAGATGTGGTGCCATTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025063.1-2084s1c1
Sequence:CCGGCTGGCTGAGTAACTGGGTAAACTCGAGTTTACCCAGTTACTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1782s1c1
Sequence:CCGGCCCTCTGAATGTTGGTTCTTACTCGAGTAAGAACCAACATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-924s1c1
Sequence:CCGGGCAGCATCCATACTGATATTTCTCGAGAAATATCAGTATGGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-269s1c1
Sequence:CCGGGCAGTTTGAATCTCAGTTGAACTCGAGTTCAACTGAGATTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1181s1c1
Sequence:CCGGCGTGCTGAAGACAATCTTATTCTCGAGAATAAGATTGTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1610s1c1
Sequence:CCGGGACCCTGAAGTTATCTCTATACTCGAGTATAGAGATAACTTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025063.1-1792s1c1
Sequence:CCGGGTTGGTTCTTACCAAGACTTACTCGAGTAAGTCTTGGTAAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025063
MROH9 MISSION shRNA shRNA Plasmid DNA
maestro heat-like repeat family member 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1658s1c1
Sequence:CCGGCAGAAGACACTGTCATCGTATCTCGAGATACGATGACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-149s1c1
Sequence:CCGGCAGTGTGAAATGGCACCACATCTCGAGATGTGGTGCCATTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025063.1-2084s1c1
Sequence:CCGGCTGGCTGAGTAACTGGGTAAACTCGAGTTTACCCAGTTACTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1782s1c1
Sequence:CCGGCCCTCTGAATGTTGGTTCTTACTCGAGTAAGAACCAACATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-924s1c1
Sequence:CCGGGCAGCATCCATACTGATATTTCTCGAGAAATATCAGTATGGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-269s1c1
Sequence:CCGGGCAGTTTGAATCTCAGTTGAACTCGAGTTCAACTGAGATTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1181s1c1
Sequence:CCGGCGTGCTGAAGACAATCTTATTCTCGAGAATAAGATTGTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1610s1c1
Sequence:CCGGGACCCTGAAGTTATCTCTATACTCGAGTATAGAGATAACTTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025063.1-1792s1c1
Sequence:CCGGGTTGGTTCTTACCAAGACTTACTCGAGTAAGTCTTGGTAAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025063
MROH9 MISSION shRNA Lentiviral Transduction Particles
maestro heat-like repeat family member 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1658s1c1
Sequence:CCGGCAGAAGACACTGTCATCGTATCTCGAGATACGATGACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-149s1c1
Sequence:CCGGCAGTGTGAAATGGCACCACATCTCGAGATGTGGTGCCATTTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025063.1-2084s1c1
Sequence:CCGGCTGGCTGAGTAACTGGGTAAACTCGAGTTTACCCAGTTACTCAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-1782s1c1
Sequence:CCGGCCCTCTGAATGTTGGTTCTTACTCGAGTAAGAACCAACATTCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025063.1-924s1c1
Sequence:CCGGGCAGCATCCATACTGATATTTCTCGAGAAATATCAGTATGGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-269s1c1
Sequence:CCGGGCAGTTTGAATCTCAGTTGAACTCGAGTTCAACTGAGATTCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1181s1c1
Sequence:CCGGCGTGCTGAAGACAATCTTATTCTCGAGAATAAGATTGTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025063.1-1610s1c1
Sequence:CCGGGACCCTGAAGTTATCTCTATACTCGAGTATAGAGATAACTTCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025063.1-1792s1c1
Sequence:CCGGGTTGGTTCTTACCAAGACTTACTCGAGTAAGTCTTGGTAAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks