EMAIL THIS PAGE TO A FRIEND

MRPL15

mitochondrial ribosomal protein L15

Synonyms: L15mt MRP-L15 MRP-L7 RPML7
UniProtKB ID: Q9P015, Q96Q54, Q9H0Y1
Gene ID:
Human(29088) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL15 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 15q. [provided by RefSeq, Jul 2008]
Mouse(27395) mitochondrial ribosomal protein L15
Rat(297799) mitochondrial ribosomal protein L15
Zebrafish(445041) mitochondrial ribosomal protein L15
fruit fly(40261) mitochondrial ribosomal protein L15
dog(477880) mitochondrial ribosomal protein L15
cow(510347) mitochondrial ribosomal protein L15
domestic cat(101095635) mitochondrial ribosomal protein L15
chicken(421121) mitochondrial ribosomal protein L15
sheep(101114367) mitochondrial ribosomal protein L15
domestic guinea pig(100720128) mitochondrial ribosomal protein L15
naked mole-rat(101709316) mitochondrial ribosomal protein L15
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101504 Anti-MRPL15 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, canine, human, bovine, zebrafish, guinea pig, horse
western blot pricing
SAB4501312 Anti-MRPL15 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA044425 Anti-MRPL15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2103933 Anti-MRPL15, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse, mouse, rat, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014175 Rosetta Predictions human pricing
NM_001106633 Rosetta Predictions rat pricing
NM_025300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149466 predicted 337
2 SASI_Hs02_00345183 predicted 923
3 SASI_Hs01_00149467 predicted 405
4 SASI_Hs02_00345184 predicted 928
5 SASI_Hs01_00149469 predicted 738
6 SASI_Hs01_00149470 predicted 462
7 SASI_Hs01_00149471 predicted 879
8 SASI_Hs02_00345185 predicted 320
9 SASI_Hs01_00149472 predicted 367
10 SASI_Hs01_00149473 predicted 333
11 SASI_Hs01_00149464 predicted 772
12 SASI_Hs01_00149465 predicted 323
13 SASI_Hs01_00149468 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220868 predicted 364
2 SASI_Rn02_00220869 predicted 1027
3 SASI_Rn02_00220870 predicted 999
4 SASI_Rn02_00220871 predicted 378
5 SASI_Rn02_00220872 predicted 332
6 SASI_Rn02_00220873 predicted 1134
7 SASI_Rn02_00220874 predicted 280
8 SASI_Rn02_00220875 predicted 1068
9 SASI_Rn02_00220876 predicted 406
10 SASI_Rn02_00220877 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327916 predicted 514
2 SASI_Mm02_00327917 predicted 416
3 SASI_Mm01_00149082 predicted 394
4 SASI_Mm02_00327918 predicted 281
5 SASI_Mm02_00327919 predicted 514
6 SASI_Mm01_00149084 predicted 351
7 SASI_Mm01_00149085 predicted 556
8 SASI_Mm01_00149087 predicted 424
9 SASI_Mm01_00149088 predicted 245
10 SASI_Mm02_00327920 predicted 338
11 SASI_Mm01_00149081 predicted 1066
12 SASI_Mm01_00149083 predicted 518
13 SASI_Mm01_00149086 predicted 1099
14 SASI_Mm01_00149089 predicted 1096
15 SASI_Mm01_00149090 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025300
VALIDATED
MRPL15 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-395s21c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-290s21c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-534s21c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-91s21c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025300.2-1687s1c1
Sequence:CCGGCCCTCTTAGGATTTACATATACTCGAGTATATGTAAATCCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-126s1c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-569s1c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-430s1c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-325s1c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025300
VALIDATED
MRPL15 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-395s21c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-290s21c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-534s21c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-91s21c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025300.2-1687s1c1
Sequence:CCGGCCCTCTTAGGATTTACATATACTCGAGTATATGTAAATCCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-126s1c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-569s1c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-430s1c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-325s1c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025300
VALIDATED
MRPL15 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-395s21c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-290s21c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-534s21c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025300.3-91s21c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025300.2-1687s1c1
Sequence:CCGGCCCTCTTAGGATTTACATATACTCGAGTATATGTAAATCCTAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-126s1c1
Sequence:CCGGGCCCAGTCCTAACTCCAGAAACTCGAGTTTCTGGAGTTAGGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-569s1c1
Sequence:CCGGCAGCCTTCTATGACCCAAGAACTCGAGTTCTTGGGTCATAGAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-430s1c1
Sequence:CCGGCAGCCGCTTAAGAGGGATTATCTCGAGATAATCCCTCTTAAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025300.2-325s1c1
Sequence:CCGGCCTTTGAGTCTCAGGAGACTACTCGAGTAGTCTCCTGAGACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014175
VALIDATED
MRPL15 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-770s21c1
Sequence:CCGGTCGCCAGGAAGTATGGTTATACTCGAGTATAACCATACTTCCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-323s21c1
Sequence:CCGGATAGTTTCAGACGCCAGTATACTCGAGTATACTGGCGTCTGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-392s21c1
Sequence:GTACCGGTTGATCCTAGTCAACCTATTGCTCGAGCAATAGGTTGACTAGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014175.3-1435s21c1
Sequence:CCGGGACGTATGCTTAAGGTGTAAGCTCGAGCTTACACCTTAAGCATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-357s21c1
Sequence:CCGGCAATAGACTGCAGTATCTTATCTCGAGATAAGATACTGCAGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-334s1c1
Sequence:CCGGCGCCAGTATAAGCCTTTGAGTCTCGAGACTCAAAGGCTTATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-963s1c1
Sequence:CCGGCCAAGGAAGCAGAGTTGTTAACTCGAGTTAACAACTCTGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014175.2-398s1c1
Sequence:CCGGCTAGTCAACCTATTGACTTAACTCGAGTTAAGTCAATAGGTTGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-1002s1c1
Sequence:CCGGCTGAAGGATCTATATTCCCTTCTCGAGAAGGGAATATAGATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-971s1c1
Sequence:CCGGGCAGAGTTGTTAAAGAGTACTCTCGAGAGTACTCTTTAACAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014175
VALIDATED
MRPL15 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-770s21c1
Sequence:CCGGTCGCCAGGAAGTATGGTTATACTCGAGTATAACCATACTTCCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-323s21c1
Sequence:CCGGATAGTTTCAGACGCCAGTATACTCGAGTATACTGGCGTCTGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-392s21c1
Sequence:GTACCGGTTGATCCTAGTCAACCTATTGCTCGAGCAATAGGTTGACTAGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014175.3-1435s21c1
Sequence:CCGGGACGTATGCTTAAGGTGTAAGCTCGAGCTTACACCTTAAGCATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-357s21c1
Sequence:CCGGCAATAGACTGCAGTATCTTATCTCGAGATAAGATACTGCAGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-334s1c1
Sequence:CCGGCGCCAGTATAAGCCTTTGAGTCTCGAGACTCAAAGGCTTATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-963s1c1
Sequence:CCGGCCAAGGAAGCAGAGTTGTTAACTCGAGTTAACAACTCTGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014175.2-398s1c1
Sequence:CCGGCTAGTCAACCTATTGACTTAACTCGAGTTAAGTCAATAGGTTGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-1002s1c1
Sequence:CCGGCTGAAGGATCTATATTCCCTTCTCGAGAAGGGAATATAGATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-971s1c1
Sequence:CCGGGCAGAGTTGTTAAAGAGTACTCTCGAGAGTACTCTTTAACAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014175
VALIDATED
MRPL15 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-770s21c1
Sequence:CCGGTCGCCAGGAAGTATGGTTATACTCGAGTATAACCATACTTCCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-323s21c1
Sequence:CCGGATAGTTTCAGACGCCAGTATACTCGAGTATACTGGCGTCTGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-392s21c1
Sequence:GTACCGGTTGATCCTAGTCAACCTATTGCTCGAGCAATAGGTTGACTAGGATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014175.3-1435s21c1
Sequence:CCGGGACGTATGCTTAAGGTGTAAGCTCGAGCTTACACCTTAAGCATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014175.3-357s21c1
Sequence:CCGGCAATAGACTGCAGTATCTTATCTCGAGATAAGATACTGCAGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-334s1c1
Sequence:CCGGCGCCAGTATAAGCCTTTGAGTCTCGAGACTCAAAGGCTTATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-963s1c1
Sequence:CCGGCCAAGGAAGCAGAGTTGTTAACTCGAGTTAACAACTCTGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014175.2-398s1c1
Sequence:CCGGCTAGTCAACCTATTGACTTAACTCGAGTTAAGTCAATAGGTTGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-1002s1c1
Sequence:CCGGCTGAAGGATCTATATTCCCTTCTCGAGAAGGGAATATAGATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014175.2-971s1c1
Sequence:CCGGGCAGAGTTGTTAAAGAGTACTCTCGAGAGTACTCTTTAACAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks