EMAIL THIS PAGE TO A FRIEND

MRPL20

mitochondrial ribosomal protein L20

Synonyms: L20mt MRP-L20
UniProtKB ID: Q9BYC9, B2RE41
Gene ID:
Human(55052) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. [provided by RefSeq, Jul 2008]
Mouse(66448) mitochondrial ribosomal protein L20
Rat(680747) mitochondrial ribosomal protein L20
sheep(101105837) mitochondrial ribosomal protein L20
domestic guinea pig(100727897) mitochondrial ribosomal protein L20
naked mole-rat(101711755) mitochondrial ribosomal protein L20
Zebrafish(751640) mitochondrial ribosomal protein L20
chicken(770979) mitochondrial ribosomal protein L20
cow(506358) mitochondrial ribosomal protein L20
domestic cat(101085535) mitochondrial ribosomal protein L20
dog(479569) mitochondrial ribosomal protein L20
fruit fly(39477) mitochondrial ribosomal protein L20
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017971 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017971 Rosetta Predictions human pricing
NM_001109428 Rosetta Predictions rat pricing
NM_025570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109156 predicted 415
2 SASI_Hs01_00109157 predicted 397
3 SASI_Hs01_00109158 predicted 344
4 SASI_Hs02_00351007 predicted 498
5 SASI_Hs01_00109159 predicted 403
6 SASI_Hs01_00109160 predicted 406
7 SASI_Hs02_00351008 predicted 494
8 SASI_Hs01_00109161 predicted 414
9 SASI_Hs01_00109162 predicted 291
10 SASI_Hs01_00109163 predicted 396
11 SASI_Hs01_00109155 predicted 260
12 SASI_Hs01_00109164 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248307 predicted 283
2 SASI_Rn02_00248308 predicted 377
3 SASI_Rn02_00248309 predicted 262
4 SASI_Rn02_00248310 predicted 413
5 SASI_Rn02_00248311 predicted 191
6 SASI_Rn02_00248312 predicted 327
7 SASI_Rn02_00248313 predicted 443
8 SASI_Rn02_00248314 predicted 524
9 SASI_Rn02_00248315 predicted 455
10 SASI_Rn02_00248316 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149881 predicted 320
2 SASI_Mm01_00149882 predicted 235
3 SASI_Mm01_00149883 predicted 274
4 SASI_Mm01_00149884 predicted 365
5 SASI_Mm02_00328546 predicted 328
6 SASI_Mm01_00149885 predicted 360
7 SASI_Mm01_00149886 predicted 285
8 SASI_Mm01_00149887 predicted 279
9 SASI_Mm01_00149888 predicted 276
10 SASI_Mm02_00328547 predicted 235
11 SASI_Mm01_00149889 predicted 364
12 SASI_Mm01_00149890 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017971
VALIDATED
MRPL20 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-460s21c1
Sequence:CCGGAGGAGGCGACACGAAGGATTTCTCGAGAAATCCTTCGTGTCGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-293s21c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-346s21c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017971.3-578s21c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-423s21c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-546s1c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-314s1c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017971.2-194s1c1
Sequence:CCGGAGAACCGTGATTCGAGCCTTTCTCGAGAAAGGCTCGAATCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-317s1c1
Sequence:CCGGGCGCTCATTGGGAATTTAGTTCTCGAGAACTAAATTCCCAATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-391s1c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017971
VALIDATED
MRPL20 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-460s21c1
Sequence:CCGGAGGAGGCGACACGAAGGATTTCTCGAGAAATCCTTCGTGTCGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-293s21c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-346s21c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017971.3-578s21c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-423s21c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-546s1c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-314s1c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017971.2-194s1c1
Sequence:CCGGAGAACCGTGATTCGAGCCTTTCTCGAGAAAGGCTCGAATCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-317s1c1
Sequence:CCGGGCGCTCATTGGGAATTTAGTTCTCGAGAACTAAATTCCCAATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-391s1c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017971
VALIDATED
MRPL20 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-460s21c1
Sequence:CCGGAGGAGGCGACACGAAGGATTTCTCGAGAAATCCTTCGTGTCGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-293s21c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-346s21c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017971.3-578s21c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017971.3-423s21c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-546s1c1
Sequence:CCGGCAGAGTAATTTGCAGTTTGTTCTCGAGAACAAACTGCAAATTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-314s1c1
Sequence:CCGGCCAGCGCTCATTGGGAATTTACTCGAGTAAATTCCCAATGAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017971.2-194s1c1
Sequence:CCGGAGAACCGTGATTCGAGCCTTTCTCGAGAAAGGCTCGAATCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-317s1c1
Sequence:CCGGGCGCTCATTGGGAATTTAGTTCTCGAGAACTAAATTCCCAATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017971.2-391s1c1
Sequence:CCGGGCCAAAGACTTTCAAATCTTTCTCGAGAAAGATTTGAAAGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025570
VALIDATED
MRPL20 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-495s1c1
Sequence:CCGGGCAGTGCTATAGACTGTTATACTCGAGTATAACAGTCTATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-236s1c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-179s1c1
Sequence:CCGGCCAGAGCCTTCGTTAAGTGTACTCGAGTACACTTAACGAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-288s1c1
Sequence:CCGGCCCAGCATTCATTGTCAACTTCTCGAGAAGTTGACAATGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-289s1c1
Sequence:CCGGCCAGCATTCATTGTCAACTTACTCGAGTAAGTTGACAATGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025570
VALIDATED
MRPL20 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-495s1c1
Sequence:CCGGGCAGTGCTATAGACTGTTATACTCGAGTATAACAGTCTATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-236s1c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-179s1c1
Sequence:CCGGCCAGAGCCTTCGTTAAGTGTACTCGAGTACACTTAACGAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-288s1c1
Sequence:CCGGCCCAGCATTCATTGTCAACTTCTCGAGAAGTTGACAATGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-289s1c1
Sequence:CCGGCCAGCATTCATTGTCAACTTACTCGAGTAAGTTGACAATGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025570
VALIDATED
MRPL20 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-495s1c1
Sequence:CCGGGCAGTGCTATAGACTGTTATACTCGAGTATAACAGTCTATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-236s1c1
Sequence:CCGGCCCTCTGGATTAATCGAATTACTCGAGTAATTCGATTAATCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-179s1c1
Sequence:CCGGCCAGAGCCTTCGTTAAGTGTACTCGAGTACACTTAACGAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-288s1c1
Sequence:CCGGCCCAGCATTCATTGTCAACTTCTCGAGAAGTTGACAATGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025570.1-289s1c1
Sequence:CCGGCCAGCATTCATTGTCAACTTACTCGAGTAAGTTGACAATGAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks