EMAIL THIS PAGE TO A FRIEND

MRPL40

mitochondrial ribosomal protein L40

Synonyms: MRP-L22 MRPL22 NLVCF URIM
UniProtKB ID: Q9NQ50, B3KVZ7, O95134
Gene ID:
Human(64976) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Deletions in this gene may contribute to the etiology of velo-cardio-facial syndrome and DiGeorge syndrome. [provided by RefSeq, Jul 2008]
Mouse(18100) mitochondrial ribosomal protein L40
Rat(287962) mitochondrial ribosomal protein L40
sheep(101120866) mitochondrial ribosomal protein L40
domestic guinea pig(100727543) mitochondrial ribosomal protein L40
naked mole-rat(101713666) mitochondrial ribosomal protein L40
Zebrafish(447873) mitochondrial ribosomal protein L40
cow(101907103) mitochondrial ribosomal protein L40
domestic cat(101098408) mitochondrial ribosomal protein L40
dog(477567) mitochondrial ribosomal protein L40
chicken(100858795) mitochondrial ribosomal protein L40
fruit fly(41364) mitochondrial ribosomal protein L40
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003776 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003776 Rosetta Predictions human pricing
NM_001024865 Rosetta Predictions rat pricing
XM_001061518 Rosetta Predictions rat pricing
NM_010922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203302 predicted 517
2 SASI_Hs01_00203303 predicted 305
3 SASI_Hs01_00203304 predicted 452
4 SASI_Hs01_00203305 predicted 435
5 SASI_Hs02_00336272 predicted 280
6 SASI_Hs01_00203306 predicted 276
7 SASI_Hs01_00203307 predicted 443
8 SASI_Hs01_00203308 predicted 442
9 SASI_Hs01_00203309 predicted 345
10 SASI_Hs01_00203310 predicted 522
11 SASI_Hs01_00203301 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097096 predicted 979
2 SASI_Rn01_00097097 predicted 762
3 SASI_Rn01_00097098 predicted 320
4 SASI_Rn01_00097099 predicted 934
5 SASI_Rn02_00202741 predicted 940
6 SASI_Rn01_00097100 predicted 942
7 SASI_Rn01_00097102 predicted 795
8 SASI_Rn02_00202742 predicted 937
9 SASI_Rn01_00097103 predicted 899
10 SASI_Rn01_00097104 predicted 526
11 SASI_Rn01_00097101 predicted 551
12 SASI_Rn01_00097105 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300347 predicted 341
2 SASI_Rn02_00300348 predicted 244
3 SASI_Rn02_00300349 predicted 587
4 SASI_Rn02_00300350 predicted 292
5 SASI_Rn02_00300351 predicted 547
6 SASI_Rn02_00300352 predicted 271
7 SASI_Rn02_00300353 predicted 281
8 SASI_Rn02_00300354 predicted 521
9 SASI_Rn02_00300355 predicted 342
10 SASI_Rn02_00300356 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109033 predicted 592
2 SASI_Mm01_00109034 predicted 419
3 SASI_Mm01_00109035 predicted 380
4 SASI_Mm01_00109036 predicted 297
5 SASI_Mm01_00109037 predicted 525
6 SASI_Mm01_00109038 predicted 576
7 SASI_Mm01_00109039 predicted 515
8 SASI_Mm01_00109040 predicted 340
9 SASI_Mm01_00109041 predicted 563
10 SASI_Mm02_00319666 predicted 558
11 SASI_Mm01_00109042 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010922
VALIDATED
MRPL40 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-262s1c1
Sequence:CCGGCTGCGGAAGAAGAAGAAGGTACTCGAGTACCTTCTTCTTCTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-481s1c1
Sequence:CCGGCTGTTTAAGCAGCAGGAGCATCTCGAGATGCTCCTGCTGCTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-301s1c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010922.1-639s1c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-355s1c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-694s1c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-639s21c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-301s21c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-694s21c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-355s21c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010922
VALIDATED
MRPL40 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-262s1c1
Sequence:CCGGCTGCGGAAGAAGAAGAAGGTACTCGAGTACCTTCTTCTTCTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-481s1c1
Sequence:CCGGCTGTTTAAGCAGCAGGAGCATCTCGAGATGCTCCTGCTGCTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-301s1c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010922.1-639s1c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-355s1c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-694s1c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-639s21c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-301s21c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-694s21c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-355s21c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010922
VALIDATED
MRPL40 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-262s1c1
Sequence:CCGGCTGCGGAAGAAGAAGAAGGTACTCGAGTACCTTCTTCTTCTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010922.1-481s1c1
Sequence:CCGGCTGTTTAAGCAGCAGGAGCATCTCGAGATGCTCCTGCTGCTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-301s1c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010922.1-639s1c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-355s1c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010922.1-694s1c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-639s21c1
Sequence:CCGGGCCACATTACACACCACCTATCTCGAGATAGGTGGTGTGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-301s21c1
Sequence:CCGGGCAGCAAAGGATCGCTTGAAACTCGAGTTTCAAGCGATCCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-694s21c1
Sequence:CCGGGATATCACCAAGGTGTACAAACTCGAGTTTGTACACCTTGGTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010922.1-355s21c1
Sequence:CCGGGAACTGATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003776
VALIDATED
MRPL40 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L40
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-414s1c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-150s1c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003776.2-283s1c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-636s1c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-280s1c1
Sequence:CCGGCAAGAGCTAATTCCTATTGAACTCGAGTTCAATAGGAATTAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-274s1c1
Sequence:CCGGGCTACTCAAGAGCTAATTCCTCTCGAGAGGAATTAGCTCTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-166s1c1
Sequence:CCGGCTCATTCCCATGAGATCAGAACTCGAGTTCTGATCTCATGGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-229s1c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-390s1c1
Sequence:CCGGGCTTCTGAAGAAGTGGTCCTTCTCGAGAAGGACCACTTCTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-630s1c1
Sequence:CCGGCAAGGTGTACACACAAGTGGACTCGAGTCCACTTGTGTGTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-283s21c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-414s21c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-229s21c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-150s21c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-636s21c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003776
VALIDATED
MRPL40 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L40
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-414s1c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-150s1c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003776.2-283s1c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-636s1c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-280s1c1
Sequence:CCGGCAAGAGCTAATTCCTATTGAACTCGAGTTCAATAGGAATTAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-274s1c1
Sequence:CCGGGCTACTCAAGAGCTAATTCCTCTCGAGAGGAATTAGCTCTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-166s1c1
Sequence:CCGGCTCATTCCCATGAGATCAGAACTCGAGTTCTGATCTCATGGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-229s1c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-390s1c1
Sequence:CCGGGCTTCTGAAGAAGTGGTCCTTCTCGAGAAGGACCACTTCTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-630s1c1
Sequence:CCGGCAAGGTGTACACACAAGTGGACTCGAGTCCACTTGTGTGTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-283s21c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-414s21c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-229s21c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-150s21c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-636s21c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003776
VALIDATED
MRPL40 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L40
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-414s1c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-150s1c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003776.2-283s1c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-636s1c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-280s1c1
Sequence:CCGGCAAGAGCTAATTCCTATTGAACTCGAGTTCAATAGGAATTAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-274s1c1
Sequence:CCGGGCTACTCAAGAGCTAATTCCTCTCGAGAGGAATTAGCTCTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-166s1c1
Sequence:CCGGCTCATTCCCATGAGATCAGAACTCGAGTTCTGATCTCATGGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-229s1c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-390s1c1
Sequence:CCGGGCTTCTGAAGAAGTGGTCCTTCTCGAGAAGGACCACTTCTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003776.2-630s1c1
Sequence:CCGGCAAGGTGTACACACAAGTGGACTCGAGTCCACTTGTGTGTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-283s21c1
Sequence:CCGGGAGCTAATTCCTATTGAAGATCTCGAGATCTTCAATAGGAATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-414s21c1
Sequence:CCGGCAAGCAGCAAGAGCGTAAGATCTCGAGATCTTACGCTCTTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-229s21c1
Sequence:CCGGGAAGCAAAGGAGCGCTTGAAACTCGAGTTTCAAGCGCTCCTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-150s21c1
Sequence:CCGGGTTGTCTTTCTGGGAACTCATCTCGAGATGAGTTCCCAGAAAGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003776.2-636s21c1
Sequence:CCGGGTACACACAAGTGGAGTTTAACTCGAGTTAAACTCCACTTGTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks