EMAIL THIS PAGE TO A FRIEND

MRPL43

mitochondrial ribosomal protein L43

Synonyms: bMRP36a
Gene ID:
Human(84545) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene and the gene for a semaphorin class 4 protein (SEMA4G) overlap at map location 10q24.31 and are transcribed in opposite directions. Sequence analysis identified multiple transcript variants encoding at least four different protein isoforms. [provided by RefSeq, Jul 2008]
Mouse(94067) mitochondrial ribosomal protein L43
Rat(309440) mitochondrial ribosomal protein L43
Zebrafish(436701) mitochondrial ribosomal protein L43
fruit fly(37750) mitochondrial ribosomal protein L43
dog(477799) mitochondrial ribosomal protein L43
domestic cat(101093715) mitochondrial ribosomal protein L43
cow(282277) mitochondrial ribosomal protein L43
naked mole-rat(101719220) mitochondrial ribosomal protein L43
domestic guinea pig(100734372) mitochondrial ribosomal protein L43
sheep(101122995) mitochondrial ribosomal protein L43
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032112 Rosetta Predictions human pricing
NM_176792 Rosetta Predictions human pricing
NM_176793 Rosetta Predictions human pricing
NM_176794 Rosetta Predictions human pricing
NM_001107598 Rosetta Predictions rat pricing
NM_053164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216473 predicted 281
2 SASI_Hs01_00216474 predicted 219
3 SASI_Hs01_00216475 predicted 287
4 SASI_Hs01_00216476 predicted 211
5 SASI_Hs01_00216477 predicted 269
6 SASI_Hs01_00216478 predicted 290
7 SASI_Hs01_00216479 predicted 281
8 SASI_Hs01_00216480 predicted 193
9 SASI_Hs01_00216481 predicted 250
10 SASI_Hs01_00216482 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049844 predicted 280
2 SASI_Hs01_00049845 predicted 224
3 SASI_Hs01_00049846 predicted 293
4 SASI_Hs01_00049847 predicted 208
5 SASI_Hs01_00049848 predicted 274
6 SASI_Hs01_00049849 predicted 291
7 SASI_Hs01_00049850 predicted 287
8 SASI_Hs01_00049851 predicted 198
9 SASI_Hs01_00049852 predicted 245
10 SASI_Hs01_00049853 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086250 predicted 284
2 SASI_Hs01_00086251 predicted 224
3 SASI_Hs01_00086252 predicted 291
4 SASI_Hs01_00086253 predicted 210
5 SASI_Hs01_00086254 predicted 270
6 SASI_Hs01_00086255 predicted 284
7 SASI_Hs01_00086256 predicted 288
8 SASI_Hs01_00086257 predicted 195
9 SASI_Hs01_00086258 predicted 249
10 SASI_Hs01_00086259 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039531 predicted 285
2 SASI_Hs01_00039532 predicted 224
3 SASI_Hs01_00039533 predicted 285
4 SASI_Hs01_00039534 predicted 209
5 SASI_Hs01_00039535 predicted 270
6 SASI_Hs01_00039536 predicted 291
7 SASI_Hs01_00039537 predicted 281
8 SASI_Hs01_00039538 predicted 196
9 SASI_Hs01_00039539 predicted 249
10 SASI_Hs01_00039540 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230415 predicted 298
2 SASI_Rn02_00230416 predicted 295
3 SASI_Rn02_00230417 predicted 306
4 SASI_Rn02_00230418 predicted 228
5 SASI_Rn02_00230419 predicted 296
6 SASI_Rn02_00230420 predicted 232
7 SASI_Rn02_00230421 predicted 352
8 SASI_Rn02_00230422 predicted 309
9 SASI_Rn02_00230423 predicted 220
10 SASI_Rn02_00230424 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337692 predicted 533
2 SASI_Mm02_00337693 predicted 372
3 SASI_Mm02_00337694 predicted 553
4 SASI_Mm02_00337695 predicted 211
5 SASI_Mm02_00337696 predicted 256
6 SASI_Mm02_00337697 predicted 215
7 SASI_Mm02_00337698 predicted 199
8 SASI_Mm02_00337699 predicted 401
9 SASI_Mm02_00337700 predicted 219
10 SASI_Mm02_00337701 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032112
VALIDATED
MRPL43 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L43
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-635s1c1
Sequence:CCGGCAGGCAAATGGAACCCATCAACTCGAGTTGATGGGTTCCATTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032112.2-702s1c1
Sequence:CCGGGTTTCTTTCCAGTGCCTGCTTCTCGAGAAGCAGGCACTGGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032112.2-582s1c1
Sequence:CCGGCTTTGGACTGTTACTCCGGTACTCGAGTACCGGAGTAACAGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-684s1c1
Sequence:CCGGGATAATGAAGAGCTGCCTGTTCTCGAGAACAGGCAGCTCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032112.2-293s1c1
Sequence:CCGGGAGTAGTGGCCGAATACCTTACTCGAGTAAGGTATTCGGCCACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-670s21c1
Sequence:CCGGGAGGTTCTGCTTGGGATAATGCTCGAGCATTATCCCAAGCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-539s21c1
Sequence:CCGGTGCAAGCACAGTGAAGAGTTGCTCGAGCAACTCTTCACTGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032112.2-294s21c1
Sequence:CCGGAGTAGTGGCCGAATACCTTAACTCGAGTTAAGGTATTCGGCCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-120s21c1
Sequence:CCGGCAACGGACTGGGTCGCTATGTCTCGAGACATAGCGACCCAGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-329s21c1
Sequence:CCGGAGGAGAGCATCCACTGCAAGTCTCGAGACTTGCAGTGGATGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032112
VALIDATED
MRPL43 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L43
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-635s1c1
Sequence:CCGGCAGGCAAATGGAACCCATCAACTCGAGTTGATGGGTTCCATTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032112.2-702s1c1
Sequence:CCGGGTTTCTTTCCAGTGCCTGCTTCTCGAGAAGCAGGCACTGGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032112.2-582s1c1
Sequence:CCGGCTTTGGACTGTTACTCCGGTACTCGAGTACCGGAGTAACAGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-684s1c1
Sequence:CCGGGATAATGAAGAGCTGCCTGTTCTCGAGAACAGGCAGCTCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032112.2-293s1c1
Sequence:CCGGGAGTAGTGGCCGAATACCTTACTCGAGTAAGGTATTCGGCCACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-670s21c1
Sequence:CCGGGAGGTTCTGCTTGGGATAATGCTCGAGCATTATCCCAAGCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-539s21c1
Sequence:CCGGTGCAAGCACAGTGAAGAGTTGCTCGAGCAACTCTTCACTGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032112.2-294s21c1
Sequence:CCGGAGTAGTGGCCGAATACCTTAACTCGAGTTAAGGTATTCGGCCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-120s21c1
Sequence:CCGGCAACGGACTGGGTCGCTATGTCTCGAGACATAGCGACCCAGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-329s21c1
Sequence:CCGGAGGAGAGCATCCACTGCAAGTCTCGAGACTTGCAGTGGATGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032112
VALIDATED
MRPL43 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L43
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-635s1c1
Sequence:CCGGCAGGCAAATGGAACCCATCAACTCGAGTTGATGGGTTCCATTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032112.2-702s1c1
Sequence:CCGGGTTTCTTTCCAGTGCCTGCTTCTCGAGAAGCAGGCACTGGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032112.2-582s1c1
Sequence:CCGGCTTTGGACTGTTACTCCGGTACTCGAGTACCGGAGTAACAGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032112.2-684s1c1
Sequence:CCGGGATAATGAAGAGCTGCCTGTTCTCGAGAACAGGCAGCTCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032112.2-293s1c1
Sequence:CCGGGAGTAGTGGCCGAATACCTTACTCGAGTAAGGTATTCGGCCACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-670s21c1
Sequence:CCGGGAGGTTCTGCTTGGGATAATGCTCGAGCATTATCCCAAGCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-539s21c1
Sequence:CCGGTGCAAGCACAGTGAAGAGTTGCTCGAGCAACTCTTCACTGTGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032112.2-294s21c1
Sequence:CCGGAGTAGTGGCCGAATACCTTAACTCGAGTTAAGGTATTCGGCCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-120s21c1
Sequence:CCGGCAACGGACTGGGTCGCTATGTCTCGAGACATAGCGACCCAGTCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032112.2-329s21c1
Sequence:CCGGAGGAGAGCATCCACTGCAAGTCTCGAGACTTGCAGTGGATGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176792
MRPL43 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L43
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000153395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-1800s1c1
Sequence:CCGGGCACCTGACAGCAATAACTTACTCGAGTAAGTTATTGCTGTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-778s1c1
Sequence:CCGGGCAGTGTCTCATACAGTGGAACTCGAGTTCCACTGTATGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176792
MRPL43 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L43
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000153395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-1800s1c1
Sequence:CCGGGCACCTGACAGCAATAACTTACTCGAGTAAGTTATTGCTGTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-778s1c1
Sequence:CCGGGCAGTGTCTCATACAGTGGAACTCGAGTTCCACTGTATGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176792
MRPL43 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L43
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000153395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-1800s1c1
Sequence:CCGGGCACCTGACAGCAATAACTTACTCGAGTAAGTTATTGCTGTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176792.1-778s1c1
Sequence:CCGGGCAGTGTCTCATACAGTGGAACTCGAGTTCCACTGTATGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053164
MRPL43 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L43
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053164.3-978s1c1
Sequence:CCGGCAGATGAATCTCTGCGTTTAACTCGAGTTAAACGCAGAGATTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053164.3-219s1c1
Sequence:CCGGGAACCCAGGAGTCGTAGTATACTCGAGTATACTACGACTCCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-631s1c1
Sequence:CCGGCCTGAGATAAAGAAGAACCTTCTCGAGAAGGTTCTTCTTTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-977s1c1
Sequence:CCGGGCAGATGAATCTCTGCGTTTACTCGAGTAAACGCAGAGATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-932s1c1
Sequence:CCGGCGTTGGTAGTGCATAACCTTTCTCGAGAAAGGTTATGCACTACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-396s21c1
Sequence:CCGGCAAGCCCTTCCACACGGACAACTCGAGTTGTCCGTGTGGAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-693s21c1
Sequence:CCGGTACCCTAATTCTGATTCAATTCTCGAGAATTGAATCAGAATTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-509s21c1
Sequence:CCGGCTTCGATGCAAGCACAGTAAACTCGAGTTTACTGTGCTTGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-218s21c1
Sequence:CCGGGGAACCCAGGAGTCGTAGTATCTCGAGATACTACGACTCCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-80s21c1
Sequence:CCGGTGACCAGCGTCCTCCATAATGCTCGAGCATTATGGAGGACGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-271s21c1
Sequence:CCGGATAGTGGCCGAATACCTTAATCTCGAGATTAAGGTATTCGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-336s21c1
Sequence:CCGGGATCAAGTCGTTGGTGCAGAACTCGAGTTCTGCACCAACGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-871s21c1
Sequence:CCGGTTGGGCAAGGCACCTTATATCCTCGAGGATATAAGGTGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-444s21c1
Sequence:CCGGCTTCACCAACAAACGGACTGCCTCGAGGCAGTCCGTTTGTTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053164
MRPL43 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L43
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053164.3-978s1c1
Sequence:CCGGCAGATGAATCTCTGCGTTTAACTCGAGTTAAACGCAGAGATTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053164.3-219s1c1
Sequence:CCGGGAACCCAGGAGTCGTAGTATACTCGAGTATACTACGACTCCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-631s1c1
Sequence:CCGGCCTGAGATAAAGAAGAACCTTCTCGAGAAGGTTCTTCTTTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-977s1c1
Sequence:CCGGGCAGATGAATCTCTGCGTTTACTCGAGTAAACGCAGAGATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-932s1c1
Sequence:CCGGCGTTGGTAGTGCATAACCTTTCTCGAGAAAGGTTATGCACTACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-396s21c1
Sequence:CCGGCAAGCCCTTCCACACGGACAACTCGAGTTGTCCGTGTGGAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-693s21c1
Sequence:CCGGTACCCTAATTCTGATTCAATTCTCGAGAATTGAATCAGAATTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-509s21c1
Sequence:CCGGCTTCGATGCAAGCACAGTAAACTCGAGTTTACTGTGCTTGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-218s21c1
Sequence:CCGGGGAACCCAGGAGTCGTAGTATCTCGAGATACTACGACTCCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-80s21c1
Sequence:CCGGTGACCAGCGTCCTCCATAATGCTCGAGCATTATGGAGGACGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-271s21c1
Sequence:CCGGATAGTGGCCGAATACCTTAATCTCGAGATTAAGGTATTCGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-336s21c1
Sequence:CCGGGATCAAGTCGTTGGTGCAGAACTCGAGTTCTGCACCAACGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-871s21c1
Sequence:CCGGTTGGGCAAGGCACCTTATATCCTCGAGGATATAAGGTGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-444s21c1
Sequence:CCGGCTTCACCAACAAACGGACTGCCTCGAGGCAGTCCGTTTGTTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053164
MRPL43 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L43
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053164.3-978s1c1
Sequence:CCGGCAGATGAATCTCTGCGTTTAACTCGAGTTAAACGCAGAGATTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053164.3-219s1c1
Sequence:CCGGGAACCCAGGAGTCGTAGTATACTCGAGTATACTACGACTCCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-631s1c1
Sequence:CCGGCCTGAGATAAAGAAGAACCTTCTCGAGAAGGTTCTTCTTTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-977s1c1
Sequence:CCGGGCAGATGAATCTCTGCGTTTACTCGAGTAAACGCAGAGATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053164.3-932s1c1
Sequence:CCGGCGTTGGTAGTGCATAACCTTTCTCGAGAAAGGTTATGCACTACCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-396s21c1
Sequence:CCGGCAAGCCCTTCCACACGGACAACTCGAGTTGTCCGTGTGGAAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-693s21c1
Sequence:CCGGTACCCTAATTCTGATTCAATTCTCGAGAATTGAATCAGAATTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-509s21c1
Sequence:CCGGCTTCGATGCAAGCACAGTAAACTCGAGTTTACTGTGCTTGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-218s21c1
Sequence:CCGGGGAACCCAGGAGTCGTAGTATCTCGAGATACTACGACTCCTGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-80s21c1
Sequence:CCGGTGACCAGCGTCCTCCATAATGCTCGAGCATTATGGAGGACGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-271s21c1
Sequence:CCGGATAGTGGCCGAATACCTTAATCTCGAGATTAAGGTATTCGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-336s21c1
Sequence:CCGGGATCAAGTCGTTGGTGCAGAACTCGAGTTCTGCACCAACGACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053164.3-871s21c1
Sequence:CCGGTTGGGCAAGGCACCTTATATCCTCGAGGATATAAGGTGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053164.3-444s21c1
Sequence:CCGGCTTCACCAACAAACGGACTGCCTCGAGGCAGTCCGTTTGTTGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks