EMAIL THIS PAGE TO A FRIEND

MRPL52

mitochondrial ribosomal protein L52

UniProtKB ID: Q86TS9, A6NMQ8, A8MYI6, G3XCN9, Q6NVH8
Gene ID:
Human(122704) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which has no bacterial homolog. Multiple transcript variants encoding different protein isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Mouse(68836) mitochondrial ribosomal protein L52
Rat(361037) mitochondrial ribosomal protein L52
fruit fly(35711) mitochondrial ribosomal protein L52
dog(480240) mitochondrial ribosomal protein L52
cow(509469) mitochondrial ribosomal protein L52
domestic cat(101089522) mitochondrial ribosomal protein L52
domestic guinea pig(100732316) mitochondrial ribosomal protein L52
naked mole-rat(101724403) mitochondrial ribosomal protein L52
sheep(101104665) mitochondrial ribosomal protein L52
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012319 Anti-MRPL52 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003221 MISSION® esiRNA esiRNA targeting mouse Mrpl52 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178336 Rosetta Predictions human pricing
NM_180982 Rosetta Predictions human pricing
NM_181304 Rosetta Predictions human pricing
NM_181305 Rosetta Predictions human pricing
NM_181306 Rosetta Predictions human pricing
NM_181307 Rosetta Predictions human pricing
NM_001108375 Rosetta Predictions rat pricing
NM_026851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105345 predicted 267
2 SASI_Hs01_00105346 predicted 34
3 SASI_Hs01_00105348 predicted 383
4 SASI_Hs01_00105349 predicted 253
5 SASI_Hs01_00105350 predicted 600
6 SASI_Hs01_00105351 predicted 525
7 SASI_Hs01_00105352 predicted 238
8 SASI_Hs01_00105353 predicted 524
9 SASI_Hs01_00105354 predicted 228
10 SASI_Hs02_00369640 predicted 586
11 SASI_Hs01_00105347 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242578 predicted 271
2 SASI_Hs01_00242580 predicted 373
3 SASI_Hs01_00242581 predicted 246
4 SASI_Hs01_00242582 predicted 588
5 SASI_Hs01_00242583 predicted 518
6 SASI_Hs01_00242584 predicted 25
7 SASI_Hs01_00242585 predicted 232
8 SASI_Hs01_00242586 predicted 516
9 SASI_Hs01_00242587 predicted 40
10 SASI_Hs02_00369920 predicted 222
11 SASI_Hs01_00242579 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115919 predicted 455
2 SASI_Hs02_00369962 predicted 561
3 SASI_Hs01_00115923 predicted 702
4 SASI_Hs02_00369963 predicted 417
5 SASI_Hs01_00115924 predicted 1256
6 SASI_Hs01_00115925 predicted 1263
7 SASI_Hs01_00115926 predicted 1155
8 SASI_Hs01_00115927 predicted 1222
9 SASI_Hs02_00369964 predicted 1251
10 SASI_Hs02_00369965 predicted 1141
11 SASI_Hs01_00115920 predicted 426
12 SASI_Hs01_00115921 predicted 438
13 SASI_Hs01_00115922 predicted 777
14 SASI_Hs01_00115928 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369966 predicted 382
2 SASI_Hs02_00369967 predicted 486
3 SASI_Hs02_00369968 predicted 629
4 SASI_Hs02_00369969 predicted 342
5 SASI_Hs02_00369970 predicted 1181
6 SASI_Hs02_00369971 predicted 1186
7 SASI_Hs02_00369972 predicted 1082
8 SASI_Hs02_00369973 predicted 1157
9 SASI_Hs02_00369974 predicted 1182
10 SASI_Hs02_00369975 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025927 predicted 279
2 SASI_Hs02_00369976 predicted 387
3 SASI_Hs01_00025931 predicted 526
4 SASI_Hs02_00369977 predicted 244
5 SASI_Hs01_00025932 predicted 1084
6 SASI_Hs01_00025933 predicted 1080
7 SASI_Hs01_00025934 predicted 977
8 SASI_Hs01_00025935 predicted 1055
9 SASI_Hs02_00369978 predicted 1084
10 SASI_Hs02_00369979 predicted 962
11 SASI_Hs01_00025928 predicted 253
12 SASI_Hs01_00025929 predicted 266
13 SASI_Hs01_00025930 predicted 600
14 SASI_Hs01_00025936 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181101 predicted 209
2 SASI_Hs01_00181102 predicted 29
3 SASI_Hs01_00181103 predicted 315
4 SASI_Hs01_00181104 predicted 530
5 SASI_Hs01_00181105 predicted 185
6 SASI_Hs01_00181106 predicted 456
7 SASI_Hs01_00181107 predicted 456
8 SASI_Hs01_00181108 predicted 189
9 SASI_Hs01_00181109 predicted 516
10 SASI_Hs01_00181110 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238049 predicted 207
2 SASI_Rn02_00238050 predicted 200
3 SASI_Rn02_00238051 predicted 209
4 SASI_Rn02_00238052 predicted 212
5 SASI_Rn02_00238053 predicted 357
6 SASI_Rn02_00238054 predicted 236
7 SASI_Rn02_00238055 predicted 312
8 SASI_Rn02_00238056 predicted 561
9 SASI_Rn02_00238057 predicted 252
10 SASI_Rn02_00238058 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068385 predicted 232
2 SASI_Mm01_00068386 predicted 265
3 SASI_Mm01_00068387 predicted 239
4 SASI_Mm01_00068388 predicted 324
5 SASI_Mm01_00068389 predicted 357
6 SASI_Mm01_00068390 predicted 341
7 SASI_Mm01_00068391 predicted 324
8 SASI_Mm01_00068392 predicted 339
9 SASI_Mm01_00068393 predicted 361
10 SASI_Mm01_00068394 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178336
VALIDATED
MRPL52 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L52
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-163s21c1
Sequence:CCGGGAGCTCCCAGACTGGTCATATCTCGAGATATGACCAGTCTGGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-598s21c1
Sequence:CCGGGTTCAGCTAAGTCTTGCTTTACTCGAGTAAAGCAAGACTTAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-275s21c1
Sequence:CCGGAGGAAATGGACGCTGGATTACCTCGAGGTAATCCAGCGTCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-450s21c1
Sequence:CCGGCTATCACCTAGATGCTTCATCCTCGAGGATGAAGCATCTAGGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-317s1c1
Sequence:CCGGGTTGCAGGAAGAACAAAGGAACTCGAGTTCCTTTGTTCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-309s1c1
Sequence:CCGGCAGCAGAAGTTGCAGGAAGAACTCGAGTTCTTCCTGCAACTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-273s1c1
Sequence:CCGGGAAATGGACGCTGGATTACAACTCGAGTTGTAATCCAGCGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-324s1c1
Sequence:CCGGGAAGAACAAAGGAAGCAGGAACTCGAGTTCCTGCTTCCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178336.1-470s1c1
Sequence:CCGGCCAGAAGATAGCCTTCACGTTCTCGAGAACGTGAAGGCTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-377s1c1
Sequence:CCGGGAGCCCACTTCCAAGTCAATACTCGAGTATTGACTTGGAAGTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-237s1c1
Sequence:CCGGGAGACGTTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-206s1c1
Sequence:CCGGGAAAGGCCAGCTTCGAAGAAACTCGAGTTTCTTCGAAGCTGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178336
VALIDATED
MRPL52 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L52
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-163s21c1
Sequence:CCGGGAGCTCCCAGACTGGTCATATCTCGAGATATGACCAGTCTGGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-598s21c1
Sequence:CCGGGTTCAGCTAAGTCTTGCTTTACTCGAGTAAAGCAAGACTTAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-275s21c1
Sequence:CCGGAGGAAATGGACGCTGGATTACCTCGAGGTAATCCAGCGTCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-450s21c1
Sequence:CCGGCTATCACCTAGATGCTTCATCCTCGAGGATGAAGCATCTAGGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-317s1c1
Sequence:CCGGGTTGCAGGAAGAACAAAGGAACTCGAGTTCCTTTGTTCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-309s1c1
Sequence:CCGGCAGCAGAAGTTGCAGGAAGAACTCGAGTTCTTCCTGCAACTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-273s1c1
Sequence:CCGGGAAATGGACGCTGGATTACAACTCGAGTTGTAATCCAGCGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-324s1c1
Sequence:CCGGGAAGAACAAAGGAAGCAGGAACTCGAGTTCCTGCTTCCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178336.1-470s1c1
Sequence:CCGGCCAGAAGATAGCCTTCACGTTCTCGAGAACGTGAAGGCTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-377s1c1
Sequence:CCGGGAGCCCACTTCCAAGTCAATACTCGAGTATTGACTTGGAAGTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-237s1c1
Sequence:CCGGGAGACGTTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-206s1c1
Sequence:CCGGGAAAGGCCAGCTTCGAAGAAACTCGAGTTTCTTCGAAGCTGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178336
VALIDATED
MRPL52 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L52
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-163s21c1
Sequence:CCGGGAGCTCCCAGACTGGTCATATCTCGAGATATGACCAGTCTGGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-598s21c1
Sequence:CCGGGTTCAGCTAAGTCTTGCTTTACTCGAGTAAAGCAAGACTTAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178336.2-275s21c1
Sequence:CCGGAGGAAATGGACGCTGGATTACCTCGAGGTAATCCAGCGTCCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178336.2-450s21c1
Sequence:CCGGCTATCACCTAGATGCTTCATCCTCGAGGATGAAGCATCTAGGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-317s1c1
Sequence:CCGGGTTGCAGGAAGAACAAAGGAACTCGAGTTCCTTTGTTCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-309s1c1
Sequence:CCGGCAGCAGAAGTTGCAGGAAGAACTCGAGTTCTTCCTGCAACTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-273s1c1
Sequence:CCGGGAAATGGACGCTGGATTACAACTCGAGTTGTAATCCAGCGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178336.1-324s1c1
Sequence:CCGGGAAGAACAAAGGAAGCAGGAACTCGAGTTCCTGCTTCCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178336.1-470s1c1
Sequence:CCGGCCAGAAGATAGCCTTCACGTTCTCGAGAACGTGAAGGCTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-377s1c1
Sequence:CCGGGAGCCCACTTCCAAGTCAATACTCGAGTATTGACTTGGAAGTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-237s1c1
Sequence:CCGGGAGACGTTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178336.1-206s1c1
Sequence:CCGGGAAAGGCCAGCTTCGAAGAAACTCGAGTTTCTTCGAAGCTGGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026851
VALIDATED
MRPL52 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein L52
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000198964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-233s1c1
Sequence:CCGGGAGAAGCTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-235s1c1
Sequence:CCGGGAAGCTTGCAAGACGAGTTGTCTCGAGACAACTCGTCTTGCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-227s1c1
Sequence:CCGGCAAAGGGAGAAGCTTGCAAGACTCGAGTCTTGCAAGCTTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-225s1c1
Sequence:CCGGCTCAAAGGGAGAAGCTTGCAACTCGAGTTGCAAGCTTCTCCCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026851
VALIDATED
MRPL52 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein L52
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000198964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-233s1c1
Sequence:CCGGGAGAAGCTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-235s1c1
Sequence:CCGGGAAGCTTGCAAGACGAGTTGTCTCGAGACAACTCGTCTTGCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-227s1c1
Sequence:CCGGCAAAGGGAGAAGCTTGCAAGACTCGAGTCTTGCAAGCTTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-225s1c1
Sequence:CCGGCTCAAAGGGAGAAGCTTGCAACTCGAGTTGCAAGCTTCTCCCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026851
VALIDATED
MRPL52 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein L52
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000198964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-233s1c1
Sequence:CCGGGAGAAGCTTGCAAGACGAGTTCTCGAGAACTCGTCTTGCAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-235s1c1
Sequence:CCGGGAAGCTTGCAAGACGAGTTGTCTCGAGACAACTCGTCTTGCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-227s1c1
Sequence:CCGGCAAAGGGAGAAGCTTGCAAGACTCGAGTCTTGCAAGCTTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026851.1-225s1c1
Sequence:CCGGCTCAAAGGGAGAAGCTTGCAACTCGAGTTGCAAGCTTCTCCCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks