EMAIL THIS PAGE TO A FRIEND

MRPS18C

mitochondrial ribosomal protein S18C

Synonyms: MRP-S18-1 MRPS18-1
UniProtKB ID: Q9Y3D5
Gene ID:
Human(51023) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 8p, 12p, 15q, and 22q. [provided by RefSeq, Jul 2008]
Mouse(68735) mitochondrial ribosomal protein S18C
Rat(289469) mitochondrial ribosomal protein S18C
Zebrafish(569841) mitochondrial ribosomal protein S18C
chicken(770813) mitochondrial ribosomal protein S18C
fruit fly(43609) mitochondrial ribosomal protein S18C
cow(613561) mitochondrial ribosomal protein S18C
domestic cat(101084190) mitochondrial ribosomal protein S18C
dog(478458) mitochondrial ribosomal protein S18C
domestic guinea pig(100730455) mitochondrial ribosomal protein S18C
naked mole-rat(101721964) mitochondrial ribosomal protein S18C
sheep(101119137) mitochondrial ribosomal protein S18C
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502095 Anti-MRPS18C antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB1303817 ANTI-RT18C (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016067 Rosetta Predictions human pricing
NM_001105996 Rosetta Predictions rat pricing
NM_026826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125964 predicted 585
2 SASI_Hs01_00125965 predicted 541
3 SASI_Hs01_00125967 predicted 597
4 SASI_Hs01_00125969 predicted 315
5 SASI_Hs01_00125971 predicted 589
6 SASI_Hs01_00125972 predicted 274
7 SASI_Hs01_00125973 predicted 295
8 SASI_Hs02_00348804 predicted 533
9 SASI_Hs02_00348805 predicted 508
10 SASI_Hs02_00348806 predicted 207
11 SASI_Hs01_00125966 predicted 790
12 SASI_Hs01_00125968 predicted 498
13 SASI_Hs01_00125970 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214602 predicted 421
2 SASI_Rn02_00214603 predicted 577
3 SASI_Rn02_00214604 predicted 234
4 SASI_Rn02_00214605 predicted 427
5 SASI_Rn02_00214606 predicted 284
6 SASI_Rn02_00214607 predicted 407
7 SASI_Rn02_00214608 predicted 222
8 SASI_Rn02_00214609 predicted 508
9 SASI_Rn02_00214610 predicted 211
10 SASI_Rn02_00214611 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101606 predicted 203
2 SASI_Mm01_00101607 predicted 248
3 SASI_Mm01_00101608 predicted 253
4 SASI_Mm01_00101609 predicted 263
5 SASI_Mm01_00101610 predicted 214
6 SASI_Mm01_00101611 predicted 218
7 SASI_Mm01_00101612 predicted 268
8 SASI_Mm02_00330979 predicted 222
9 SASI_Mm01_00101613 predicted 208
10 SASI_Mm01_00101614 predicted 253
11 SASI_Mm01_00101615 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026826
MRPS18C MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-256s1c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-214s1c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-342s1c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-194s1c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-326s1c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-194s21c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-326s21c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-342s21c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-256s21c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-214s21c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026826
MRPS18C MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-256s1c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-214s1c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-342s1c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-194s1c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-326s1c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-194s21c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-326s21c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-342s21c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-256s21c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-214s21c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026826
MRPS18C MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-256s1c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-214s1c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-342s1c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-194s1c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026826.1-326s1c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-194s21c1
Sequence:CCGGGCCTCTTAAGAAGTGTGTCTTCTCGAGAAGACACACTTCTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-326s21c1
Sequence:CCGGGAGGGAAATAACTAAAGCCATCTCGAGATGGCTTTAGTTATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-342s21c1
Sequence:CCGGGCCATTAAGAGAGCTCAGAAACTCGAGTTTCTGAGCTCTCTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-256s21c1
Sequence:CCGGCCCAGTTTATTTCTCCATTTACTCGAGTAAATGGAGAAATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026826.1-214s21c1
Sequence:CCGGTGTGTGAGAAACGTGTAGATTCTCGAGAATCTACACGTTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016067
VALIDATED
MRPS18C MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016067.1-611s1c1
Sequence:CCGGCCCTTCATACCAATGTCCATTCTCGAGAATGGACATTGGTATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-95s1c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-172s1c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-420s1c1
Sequence:CCGGCCAGTTACATACAAGGATCCTCTCGAGAGGATCCTTGTATGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016067.1-441s1c1
Sequence:CCGGGCATATCTCAAGGACCCTAAACTCGAGTTTAGGGTCCTTGAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-337s1c1
Sequence:CCGGGAAGGCACATTACAGGTCTTTCTCGAGAAAGACCTGTAATGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-328s1c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-449s1c1
Sequence:CCGGCAAGGACCCTAAAGTTTGTAACTCGAGTTACAAACTTTAGGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-251s21c1
Sequence:CCGGCAATGAGGACCTGCCCATTTCCTCGAGGAAATGGGCAGGTCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-291s21c1
Sequence:CCGGGAACCTCTTAAGAAATGTATCCTCGAGGATACATTTCTTAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-149s21c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-226s21c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-382s21c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016067
VALIDATED
MRPS18C MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016067.1-611s1c1
Sequence:CCGGCCCTTCATACCAATGTCCATTCTCGAGAATGGACATTGGTATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-95s1c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-172s1c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-420s1c1
Sequence:CCGGCCAGTTACATACAAGGATCCTCTCGAGAGGATCCTTGTATGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016067.1-441s1c1
Sequence:CCGGGCATATCTCAAGGACCCTAAACTCGAGTTTAGGGTCCTTGAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-337s1c1
Sequence:CCGGGAAGGCACATTACAGGTCTTTCTCGAGAAAGACCTGTAATGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-328s1c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-449s1c1
Sequence:CCGGCAAGGACCCTAAAGTTTGTAACTCGAGTTACAAACTTTAGGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-251s21c1
Sequence:CCGGCAATGAGGACCTGCCCATTTCCTCGAGGAAATGGGCAGGTCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-291s21c1
Sequence:CCGGGAACCTCTTAAGAAATGTATCCTCGAGGATACATTTCTTAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-149s21c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-226s21c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-382s21c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016067
VALIDATED
MRPS18C MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016067.1-611s1c1
Sequence:CCGGCCCTTCATACCAATGTCCATTCTCGAGAATGGACATTGGTATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-95s1c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-172s1c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-420s1c1
Sequence:CCGGCCAGTTACATACAAGGATCCTCTCGAGAGGATCCTTGTATGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016067.1-441s1c1
Sequence:CCGGGCATATCTCAAGGACCCTAAACTCGAGTTTAGGGTCCTTGAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-337s1c1
Sequence:CCGGGAAGGCACATTACAGGTCTTTCTCGAGAAAGACCTGTAATGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016067.1-328s1c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016067.1-449s1c1
Sequence:CCGGCAAGGACCCTAAAGTTTGTAACTCGAGTTACAAACTTTAGGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-251s21c1
Sequence:CCGGCAATGAGGACCTGCCCATTTCCTCGAGGAAATGGGCAGGTCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-291s21c1
Sequence:CCGGGAACCTCTTAAGAAATGTATCCTCGAGGATACATTTCTTAAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-149s21c1
Sequence:CCGGGAGGAAGAAGTTGACACACTTCTCGAGAAGTGTGTCAACTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-226s21c1
Sequence:CCGGGAGGTTGTTCACAACAGGTATCTCGAGATACCTGTTGTGAACAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016067.2-382s21c1
Sequence:CCGGGCATTTATGGAAGGCACATTACTCGAGTAATGTGCCTTCCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks