EMAIL THIS PAGE TO A FRIEND

MRPS30

mitochondrial ribosomal protein S30

Synonyms: MRP-S30 PAP PDCD9 S30mt
UniProtKB ID: Q9NP92, Q96I91, Q96Q19, Q9H0P8, Q9NSF9, Q9NZ76
Gene ID:
Human(10884) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Mouse(59054) mitochondrial ribosomal protein S30
Rat(294767) mitochondrial ribosomal protein S30
Zebrafish(555760) mitochondrial ribosomal protein S30
cow(516084) mitochondrial ribosomal protein S30
domestic cat(101092742) mitochondrial ribosomal protein S30
dog(479341) mitochondrial ribosomal protein S30
fruit fly(32530) mitochondrial ribosomal protein S30
chicken(395781) mitochondrial ribosomal protein S30
sheep(101121547) mitochondrial ribosomal protein S30
naked mole-rat(101706990) mitochondrial ribosomal protein S30
domestic guinea pig(100729815) mitochondrial ribosomal protein S30
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016640 Rosetta Predictions human pricing
NM_001106412 Rosetta Predictions rat pricing
NM_021556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179155 predicted 838
2 SASI_Hs02_00349805 predicted 745
3 SASI_Hs02_00349806 predicted 1375
4 SASI_Hs01_00179158 predicted 751
5 SASI_Hs01_00179159 predicted 767
6 SASI_Hs01_00179160 predicted 1299
7 SASI_Hs02_00349807 predicted 742
8 SASI_Hs01_00179161 predicted 725
9 SASI_Hs01_00179162 predicted 721
10 SASI_Hs01_00179163 predicted 1080
11 SASI_Hs01_00179156 predicted 1255
12 SASI_Hs01_00179157 predicted 1433
13 SASI_Hs01_00179164 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218708 predicted 771
2 SASI_Rn02_00218709 predicted 734
3 SASI_Rn02_00218710 predicted 1188
4 SASI_Rn02_00218711 predicted 822
5 SASI_Rn02_00218712 predicted 681
6 SASI_Rn02_00218713 predicted 889
7 SASI_Rn02_00218714 predicted 910
8 SASI_Rn02_00218715 predicted 697
9 SASI_Rn02_00218716 predicted 1036
10 SASI_Rn02_00218717 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326335 predicted 870
2 SASI_Mm01_00075071 predicted 793
3 SASI_Mm01_00075072 predicted 708
4 SASI_Mm01_00075073 predicted 1071
5 SASI_Mm01_00075074 predicted 712
6 SASI_Mm01_00075075 predicted 830
7 SASI_Mm01_00075076 predicted 741
8 SASI_Mm01_00075078 predicted 668
9 SASI_Mm01_00075079 predicted 1255
10 SASI_Mm01_00075080 predicted 810
11 SASI_Mm01_00075077 predicted 1322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021556
VALIDATED
MRPS30 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S30
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1394s21c1
Sequence:CCGGGTGTAACTGTCTGCTATTAAACTCGAGTTTAATAGCAGACAGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1262s21c1
Sequence:CCGGTAGTTCACTTTCTGCTAAATACTCGAGTATTTAGCAGAAAGTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-711s21c1
Sequence:CCGGACACAACCAGATTCGAATATCCTCGAGGATATTCGAATCTGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-678s21c1
Sequence:CCGGTGATGCTTTACGATACCAAATCTCGAGATTTGGTATCGTAAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1335s21c1
Sequence:CCGGTCTGGGACCTTGACGAGATTTCTCGAGAAATCTCGTCAAGGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-673s1c1
Sequence:CCGGGCCATATTGATGCTTTACGATCTCGAGATCGTAAAGCATCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-816s1c1
Sequence:CCGGCCATTGTTCAGACGGCAGTATCTCGAGATACTGCCGTCTGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021556
VALIDATED
MRPS30 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S30
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1394s21c1
Sequence:CCGGGTGTAACTGTCTGCTATTAAACTCGAGTTTAATAGCAGACAGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1262s21c1
Sequence:CCGGTAGTTCACTTTCTGCTAAATACTCGAGTATTTAGCAGAAAGTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-711s21c1
Sequence:CCGGACACAACCAGATTCGAATATCCTCGAGGATATTCGAATCTGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-678s21c1
Sequence:CCGGTGATGCTTTACGATACCAAATCTCGAGATTTGGTATCGTAAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1335s21c1
Sequence:CCGGTCTGGGACCTTGACGAGATTTCTCGAGAAATCTCGTCAAGGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-673s1c1
Sequence:CCGGGCCATATTGATGCTTTACGATCTCGAGATCGTAAAGCATCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-816s1c1
Sequence:CCGGCCATTGTTCAGACGGCAGTATCTCGAGATACTGCCGTCTGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021556
VALIDATED
MRPS30 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S30
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1394s21c1
Sequence:CCGGGTGTAACTGTCTGCTATTAAACTCGAGTTTAATAGCAGACAGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1262s21c1
Sequence:CCGGTAGTTCACTTTCTGCTAAATACTCGAGTATTTAGCAGAAAGTGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-711s21c1
Sequence:CCGGACACAACCAGATTCGAATATCCTCGAGGATATTCGAATCTGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-678s21c1
Sequence:CCGGTGATGCTTTACGATACCAAATCTCGAGATTTGGTATCGTAAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021556.3-1335s21c1
Sequence:CCGGTCTGGGACCTTGACGAGATTTCTCGAGAAATCTCGTCAAGGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-673s1c1
Sequence:CCGGGCCATATTGATGCTTTACGATCTCGAGATCGTAAAGCATCAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021556.2-816s1c1
Sequence:CCGGCCATTGTTCAGACGGCAGTATCTCGAGATACTGCCGTCTGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016640
VALIDATED
MRPS30 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S30
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016640.3-853s21c1
Sequence:GTACCGGCATTATTCAAACGGCAGTATGCTCGAGCATACTGCCGTTTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-1423s21c1
Sequence:CCGGGATTTGTAACTGTCAACTATTCTCGAGAATAGTTGACAGTTACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-936s21c1
Sequence:CCGGCATCTGTTACCTGACAAATTACTCGAGTAATTTGTCAGGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-725s21c1
Sequence:CCGGGCGATACCAGATAGATGATAACTCGAGTTATCATCTATCTGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-697s21c1
Sequence:CCGGGTCATCGAAGAGGTCGAATTGCTCGAGCAATTCGACCTCTTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-945s1c1
Sequence:CCGGCCTGACAAATTAAGAAGGGAACTCGAGTTCCCTTCTTAATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-852s1c1
Sequence:CCGGCCATTATTCAAACGGCAGTATCTCGAGATACTGCCGTTTGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016640
VALIDATED
MRPS30 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S30
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016640.3-853s21c1
Sequence:GTACCGGCATTATTCAAACGGCAGTATGCTCGAGCATACTGCCGTTTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-1423s21c1
Sequence:CCGGGATTTGTAACTGTCAACTATTCTCGAGAATAGTTGACAGTTACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-936s21c1
Sequence:CCGGCATCTGTTACCTGACAAATTACTCGAGTAATTTGTCAGGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-725s21c1
Sequence:CCGGGCGATACCAGATAGATGATAACTCGAGTTATCATCTATCTGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-697s21c1
Sequence:CCGGGTCATCGAAGAGGTCGAATTGCTCGAGCAATTCGACCTCTTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-945s1c1
Sequence:CCGGCCTGACAAATTAAGAAGGGAACTCGAGTTCCCTTCTTAATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-852s1c1
Sequence:CCGGCCATTATTCAAACGGCAGTATCTCGAGATACTGCCGTTTGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016640
VALIDATED
MRPS30 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S30
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016640.3-853s21c1
Sequence:GTACCGGCATTATTCAAACGGCAGTATGCTCGAGCATACTGCCGTTTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-1423s21c1
Sequence:CCGGGATTTGTAACTGTCAACTATTCTCGAGAATAGTTGACAGTTACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-936s21c1
Sequence:CCGGCATCTGTTACCTGACAAATTACTCGAGTAATTTGTCAGGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-725s21c1
Sequence:CCGGGCGATACCAGATAGATGATAACTCGAGTTATCATCTATCTGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016640.3-697s21c1
Sequence:CCGGGTCATCGAAGAGGTCGAATTGCTCGAGCAATTCGACCTCTTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-945s1c1
Sequence:CCGGCCTGACAAATTAAGAAGGGAACTCGAGTTCCCTTCTTAATTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016640.2-852s1c1
Sequence:CCGGCCATTATTCAAACGGCAGTATCTCGAGATACTGCCGTTTGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks