EMAIL THIS PAGE TO A FRIEND

MRPS7

mitochondrial ribosomal protein S7

Synonyms: MRP-S MRP-S7 RP-S7 RPMS7 S7mt bMRP27a
UniProtKB ID: Q9Y2R9, B2R9N5, Q53GD6
Gene ID:
Human(51081) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. In the prokaryotic ribosome, the comparable protein is thought to play an essential role in organizing the 3' domain of the 16 S rRNA in the vicinity of the P- and A-sites. Pseudogenes corresponding to this gene are found on chromosomes 8p and 12p. [provided by RefSeq, Jul 2008]
Mouse(50529) mitchondrial ribosomal protein S7
Rat(113958) mitochondrial ribosomal protein S7
Zebrafish(619204) mitochondrial ribosomal protein S7
cow(509115) mitochondrial ribosomal protein S7
domestic cat(101099162) mitochondrial ribosomal protein S7
dog(609623) mitochondrial ribosomal protein S7
chicken(422122) mitochondrial ribosomal protein S7
fruit fly(34412) mitochondrial ribosomal protein S7
sheep(101110157) mitochondrial ribosomal protein S7
naked mole-rat(101712922) mitochondrial ribosomal protein S7
domestic guinea pig(100714708) mitochondrial ribosomal protein S7
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015971 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015971 Rosetta Predictions human pricing
XM_001081692 Rosetta Predictions rat pricing
XM_213513 Rosetta Predictions rat pricing
NM_025305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026574 predicted 1094
2 SASI_Hs01_00026575 predicted 1040
3 SASI_Hs01_00026576 predicted 468
4 SASI_Hs01_00026577 predicted 325
5 SASI_Hs01_00026578 predicted 333
6 SASI_Hs01_00026579 predicted 1171
7 SASI_Hs01_00026580 predicted 1098
8 SASI_Hs02_00348637 predicted 356
9 SASI_Hs01_00026581 predicted 1152
10 SASI_Hs01_00026582 predicted 985
11 SASI_Hs01_00026583 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373041 predicted 1193
2 SASI_Rn02_00373042 predicted 601
3 SASI_Rn02_00373043 predicted 963
4 SASI_Rn02_00373044 predicted 1125
5 SASI_Rn02_00373045 predicted 480
6 SASI_Rn02_00373046 predicted 805
7 SASI_Rn02_00373047 predicted 473
8 SASI_Rn02_00373048 predicted 1052
9 SASI_Rn02_00373049 predicted 821
10 SASI_Rn02_00373050 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374666 predicted 1202
2 SASI_Rn02_00374667 predicted 602
3 SASI_Rn02_00374668 predicted 960
4 SASI_Rn02_00374669 predicted 1128
5 SASI_Rn02_00374670 predicted 476
6 SASI_Rn02_00374671 predicted 804
7 SASI_Rn02_00374672 predicted 474
8 SASI_Rn02_00374673 predicted 1045
9 SASI_Rn02_00374674 predicted 820
10 SASI_Rn02_00374675 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151480 predicted 340
2 SASI_Mm01_00151481 predicted 597
3 SASI_Mm01_00151482 predicted 1061
4 SASI_Mm01_00151483 predicted 297
5 SASI_Mm01_00151484 predicted 667
6 SASI_Mm01_00151485 predicted 710
7 SASI_Mm01_00151486 predicted 439
8 SASI_Mm01_00151487 predicted 1080
9 SASI_Mm01_00151488 predicted 679
10 SASI_Mm01_00151489 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025305
VALIDATED
MRPS7 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-602s21c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-440s21c1
Sequence:CCGGATCTTCCACGAGGCACTCAAACTCGAGTTTGAGTGCCTCGTGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025305.2-893s21c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-140s21c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-184s21c1
Sequence:CCGGCACCGAAGAGGAGAAGTATGACTCGAGTCATACTTCTCCTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-893s1c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-602s1c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-140s1c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-676s1c1
Sequence:CCGGGAAGCACAATATGCATAAGATCTCGAGATCTTATGCATATTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-283s1c1
Sequence:CCGGCAGCAAATTCACCAACATGATCTCGAGATCATGTTGGTGAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025305
VALIDATED
MRPS7 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-602s21c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-440s21c1
Sequence:CCGGATCTTCCACGAGGCACTCAAACTCGAGTTTGAGTGCCTCGTGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025305.2-893s21c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-140s21c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-184s21c1
Sequence:CCGGCACCGAAGAGGAGAAGTATGACTCGAGTCATACTTCTCCTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-893s1c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-602s1c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-140s1c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-676s1c1
Sequence:CCGGGAAGCACAATATGCATAAGATCTCGAGATCTTATGCATATTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-283s1c1
Sequence:CCGGCAGCAAATTCACCAACATGATCTCGAGATCATGTTGGTGAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025305
VALIDATED
MRPS7 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-602s21c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025305.2-440s21c1
Sequence:CCGGATCTTCCACGAGGCACTCAAACTCGAGTTTGAGTGCCTCGTGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025305.2-893s21c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-140s21c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025305.2-184s21c1
Sequence:CCGGCACCGAAGAGGAGAAGTATGACTCGAGTCATACTTCTCCTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-893s1c1
Sequence:CCGGCCTGTTCCAAAGGTTTCGATACTCGAGTATCGAAACCTTTGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-602s1c1
Sequence:CCGGCGGACACTTATGCCAGAGAAACTCGAGTTTCTCTGGCATAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-140s1c1
Sequence:CCGGCCCTTGATTGACAAGGAATATCTCGAGATATTCCTTGTCAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-676s1c1
Sequence:CCGGGAAGCACAATATGCATAAGATCTCGAGATCTTATGCATATTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025305.1-283s1c1
Sequence:CCGGCAGCAAATTCACCAACATGATCTCGAGATCATGTTGGTGAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015971
VALIDATED
MRPS7 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-325s21c1
Sequence:CCGGAGGTGAGATGGAGCCGCTATACTCGAGTATAGCGGCTCCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-795s21c1
Sequence:CCGGATCACTGAGTGCCGGGATAAACTCGAGTTTATCCCGGCACTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-494s21c1
Sequence:GTACCGGAGACCCAGTCATCAGTAAATTCTCGAGAATTTACTGATGACTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-1236s21c1
Sequence:CCGGGGGCGGACCTTTGGATATATACTCGAGTATATATCCAAAGGTCCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-365s21c1
Sequence:CCGGCTTGATTGACAAGGAATATTACTCGAGTAATATTCCTTGTCAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015971.2-952s1c1
Sequence:CCGGCGCAAGAAACAGTGTGAGCTACTCGAGTAGCTCACACTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-319s1c1
Sequence:CCGGGATCCCTTGATTGACAAGGAACTCGAGTTCCTTGTCAATCAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-321s1c1
Sequence:CCGGTCCCTTGATTGACAAGGAATACTCGAGTATTCCTTGTCAATCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-451s1c1
Sequence:CCGGGAAGACCCAGTCATCAGTAAACTCGAGTTTACTGATGACTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-613s1c1
Sequence:CCGGCCCTACACCATCTTCCATCAACTCGAGTTGATGGAAGATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015971
VALIDATED
MRPS7 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-325s21c1
Sequence:CCGGAGGTGAGATGGAGCCGCTATACTCGAGTATAGCGGCTCCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-795s21c1
Sequence:CCGGATCACTGAGTGCCGGGATAAACTCGAGTTTATCCCGGCACTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-494s21c1
Sequence:GTACCGGAGACCCAGTCATCAGTAAATTCTCGAGAATTTACTGATGACTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-1236s21c1
Sequence:CCGGGGGCGGACCTTTGGATATATACTCGAGTATATATCCAAAGGTCCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-365s21c1
Sequence:CCGGCTTGATTGACAAGGAATATTACTCGAGTAATATTCCTTGTCAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015971.2-952s1c1
Sequence:CCGGCGCAAGAAACAGTGTGAGCTACTCGAGTAGCTCACACTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-319s1c1
Sequence:CCGGGATCCCTTGATTGACAAGGAACTCGAGTTCCTTGTCAATCAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-321s1c1
Sequence:CCGGTCCCTTGATTGACAAGGAATACTCGAGTATTCCTTGTCAATCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-451s1c1
Sequence:CCGGGAAGACCCAGTCATCAGTAAACTCGAGTTTACTGATGACTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-613s1c1
Sequence:CCGGCCCTACACCATCTTCCATCAACTCGAGTTGATGGAAGATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015971
VALIDATED
MRPS7 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-325s21c1
Sequence:CCGGAGGTGAGATGGAGCCGCTATACTCGAGTATAGCGGCTCCATCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-795s21c1
Sequence:CCGGATCACTGAGTGCCGGGATAAACTCGAGTTTATCCCGGCACTCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-494s21c1
Sequence:GTACCGGAGACCCAGTCATCAGTAAATTCTCGAGAATTTACTGATGACTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-1236s21c1
Sequence:CCGGGGGCGGACCTTTGGATATATACTCGAGTATATATCCAAAGGTCCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015971.3-365s21c1
Sequence:CCGGCTTGATTGACAAGGAATATTACTCGAGTAATATTCCTTGTCAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015971.2-952s1c1
Sequence:CCGGCGCAAGAAACAGTGTGAGCTACTCGAGTAGCTCACACTGTTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-319s1c1
Sequence:CCGGGATCCCTTGATTGACAAGGAACTCGAGTTCCTTGTCAATCAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-321s1c1
Sequence:CCGGTCCCTTGATTGACAAGGAATACTCGAGTATTCCTTGTCAATCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-451s1c1
Sequence:CCGGGAAGACCCAGTCATCAGTAAACTCGAGTTTACTGATGACTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015971.2-613s1c1
Sequence:CCGGCCCTACACCATCTTCCATCAACTCGAGTTGATGGAAGATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks