EMAIL THIS PAGE TO A FRIEND

MS4A13

membrane-spanning 4-domains, subfamily A, member 13

UniProtKB ID: Q5J8X5, B2RTS9, Q5J8X3, Q5J8X4
Gene ID:
Mouse(73466) membrane-spanning 4-domains, subfamily A, member 13
domestic cat(101080482) membrane-spanning 4-domains, subfamily A, member 13
cow(505705) membrane-spanning 4-domains, subfamily A, member 13
sheep(101113527) membrane-spanning 4-domains, subfamily A, member 13
naked mole-rat(101717108) membrane-spanning 4-domains, subfamily A, member 13
domestic guinea pig(100720598) membrane-spanning 4-domains, subfamily A, member 13
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126941 MISSION® esiRNA esiRNA human MS4A13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012417 Rosetta Predictions human pricing
NM_001100909 Rosetta Predictions human pricing
NM_198224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306124 predicted 499
2 SASI_Hs02_00306125 predicted 504
3 SASI_Hs02_00306126 predicted 459
4 SASI_Hs02_00306127 predicted 390
5 SASI_Hs02_00306128 predicted 570
6 SASI_Hs02_00306129 predicted 712
7 SASI_Hs02_00306130 predicted 388
8 SASI_Hs01_00237756 predicted 697
9 SASI_Hs02_00306131 predicted 486
10 SASI_Hs02_00306132 predicted 784
11 SASI_Hs01_00237757 predicted 701
12 SASI_Hs01_00237758 predicted 686
13 SASI_Hs01_00237759 predicted 704
14 SASI_Hs01_00237760 predicted 698
15 SASI_Hs01_00237761 predicted 693
16 SASI_Hs01_00237762 predicted 692
17 SASI_Hs01_00237763 predicted 663
18 SASI_Hs01_00237764 predicted 668
19 SASI_Hs01_00237765 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322485 predicted 718
2 SASI_Hs02_00322486 predicted 396
3 SASI_Hs02_00322487 predicted 732
4 SASI_Hs02_00322488 predicted 464
5 SASI_Hs02_00322489 predicted 481
6 SASI_Hs02_00322490 predicted 389
7 SASI_Hs02_00322491 predicted 574
8 SASI_Hs02_00322492 predicted 480
9 SASI_Hs02_00322493 predicted 656
10 SASI_Hs02_00322494 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151069 predicted 300
2 SASI_Mm01_00151070 predicted 302
3 SASI_Mm01_00151071 predicted 485
4 SASI_Mm01_00151072 predicted 704
5 SASI_Mm02_00350895 predicted 350
6 SASI_Mm01_00151073 predicted 495
7 SASI_Mm01_00151074 predicted 800
8 SASI_Mm01_00151075 predicted 509
9 SASI_Mm01_00151077 predicted 580
10 SASI_Mm01_00151078 predicted 775
11 SASI_Mm01_00151076 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012417
MS4A13 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-395s1c1
Sequence:CCGGCTTTGGAACGTATGAACCTGTCTCGAGACAGGTTCATACGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-491s1c1
Sequence:CCGGGTATCCGACTCGATCTGGAATCTCGAGATTCCAGATCGAGTCGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-462s1c1
Sequence:CCGGGCAGGAGTCTTCCTAATAAGACTCGAGTCTTATTAGGAAGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-660s1c1
Sequence:CCGGCTGTTCTTCTACGGTTTGGAACTCGAGTTCCAAACCGTAGAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-400s1c1
Sequence:CCGGGAACGTATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-496s1c1
Sequence:CCGGCGACTCGATCTGGAATTATAACTCGAGTTATAATTCCAGATCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-403s1c1
Sequence:CCGGCGTATGAACCTGTAACTTACACTCGAGTGTAAGTTACAGGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012417
MS4A13 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-395s1c1
Sequence:CCGGCTTTGGAACGTATGAACCTGTCTCGAGACAGGTTCATACGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-491s1c1
Sequence:CCGGGTATCCGACTCGATCTGGAATCTCGAGATTCCAGATCGAGTCGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-462s1c1
Sequence:CCGGGCAGGAGTCTTCCTAATAAGACTCGAGTCTTATTAGGAAGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-660s1c1
Sequence:CCGGCTGTTCTTCTACGGTTTGGAACTCGAGTTCCAAACCGTAGAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-400s1c1
Sequence:CCGGGAACGTATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-496s1c1
Sequence:CCGGCGACTCGATCTGGAATTATAACTCGAGTTATAATTCCAGATCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-403s1c1
Sequence:CCGGCGTATGAACCTGTAACTTACACTCGAGTGTAAGTTACAGGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012417
MS4A13 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-395s1c1
Sequence:CCGGCTTTGGAACGTATGAACCTGTCTCGAGACAGGTTCATACGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-491s1c1
Sequence:CCGGGTATCCGACTCGATCTGGAATCTCGAGATTCCAGATCGAGTCGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-462s1c1
Sequence:CCGGGCAGGAGTCTTCCTAATAAGACTCGAGTCTTATTAGGAAGACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-660s1c1
Sequence:CCGGCTGTTCTTCTACGGTTTGGAACTCGAGTTCCAAACCGTAGAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-400s1c1
Sequence:CCGGGAACGTATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012417.1-496s1c1
Sequence:CCGGCGACTCGATCTGGAATTATAACTCGAGTTATAATTCCAGATCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012417.1-403s1c1
Sequence:CCGGCGTATGAACCTGTAACTTACACTCGAGTGTAAGTTACAGGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198224
MS4A13 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-389s1c1
Sequence:CCGGGAACATATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-301s1c1
Sequence:CCGGGTTATCCAGATTATGATTGGACTCGAGTCCAATCATAATCTGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-563s1c1
Sequence:CCGGCAATAGTGGAATTGTCTCATTCTCGAGAATGAGACAATTCCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-528s1c1
Sequence:CCGGCTGCATAATTATTACGATCGTCTCGAGACGATCGTAATAATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198224
MS4A13 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-389s1c1
Sequence:CCGGGAACATATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-301s1c1
Sequence:CCGGGTTATCCAGATTATGATTGGACTCGAGTCCAATCATAATCTGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-563s1c1
Sequence:CCGGCAATAGTGGAATTGTCTCATTCTCGAGAATGAGACAATTCCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-528s1c1
Sequence:CCGGCTGCATAATTATTACGATCGTCTCGAGACGATCGTAATAATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198224
MS4A13 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-389s1c1
Sequence:CCGGGAACATATGAACCTGTAACTTCTCGAGAAGTTACAGGTTCATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-301s1c1
Sequence:CCGGGTTATCCAGATTATGATTGGACTCGAGTCCAATCATAATCTGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-563s1c1
Sequence:CCGGCAATAGTGGAATTGTCTCATTCTCGAGAATGAGACAATTCCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198224.1-528s1c1
Sequence:CCGGCTGCATAATTATTACGATCGTCTCGAGACGATCGTAATAATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks