EMAIL THIS PAGE TO A FRIEND

MS4A1

membrane-spanning 4-domains, subfamily A, member 1

Synonyms: B1 Bp35 CD20 CVID5 LEU-16 MS4A2 S7
UniProtKB ID: P11836, A6NMS4, P08984, Q13963
Gene ID:
Human(931) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(12482) membrane-spanning 4-domains, subfamily A, member 1
Rat(309217) membrane-spanning 4-domains, subfamily A, member 1
sheep(101113271) membrane-spanning 4-domains, subfamily A, member 1
domestic guinea pig(100720043) membrane-spanning 4-domains, subfamily A, member 1
naked mole-rat(101716753) membrane-spanning 4-domains, subfamily A, member 1
dog(485430) membrane-spanning 4-domains, subfamily A, member 1
domestic cat(494216) membrane-spanning 4-domains, subfamily A, member 1
cow(505653) membrane-spanning 4-domains, subfamily A, member 1
Horse(100059000) membrane-spanning 4-domains, subfamily A, member 1
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500049 Anti-CD20 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP32, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB2501128 Anti-MS4A1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405580 Anti-MS4A1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA014341 Anti-MS4A1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA014391 Anti-MS4A1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4700114 Monoclonal Anti-CD20 antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700119 Monoclonal Anti-CD20 antibody produced in mouse clone MEM-269, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700121 Monoclonal Anti-CD20 antibody produced in mouse clone MEM-97, purified immunoglobulin, buffered aqueous solution pig, bovine, human
flow cytometry pricing
SAB4700120 Monoclonal Anti-CD20, azide free antibody produced in mouse clone MEM-97, purified immunoglobulin, buffered aqueous solution pig, human, bovine
flow cytometry pricing
SAB4700115 Monoclonal Anti-CD20-APC antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700116 Monoclonal Anti-CD20-Biotin antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700117 Monoclonal Anti-CD20-FITC antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700118 Monoclonal Anti-CD20-PE antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
WH0000931M1 Monoclonal Anti-MS4A1 antibody produced in mouse clone 5C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403646 Monoclonal Anti-MS4A1 antibody produced in mouse clone 4F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129481 MISSION® esiRNA esiRNA human MS4A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021950 Rosetta Predictions human pricing
NM_152866 Rosetta Predictions human pricing
NM_001107578 Rosetta Predictions rat pricing
NM_007641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201279 predicted 473
2 SASI_Hs01_00201280 predicted 1099
3 SASI_Hs01_00201283 predicted 1111
4 SASI_Hs01_00201284 predicted 623
5 SASI_Hs01_00201281 predicted 180
6 SASI_Hs01_00201282 predicted 677
7 SASI_Hs01_00201285 predicted 692
8 SASI_Hs01_00201286 predicted 525
9 SASI_Hs02_00355274 predicted 879
10 SASI_Hs02_00355275 predicted 697
11 SASI_Hs01_00201277 predicted 540
12 SASI_Hs01_00201278 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163546 predicted 734
2 SASI_Hs01_00163547 predicted 1356
3 SASI_Hs01_00163550 predicted 1372
4 SASI_Hs01_00163551 predicted 889
5 SASI_Hs01_00163548 predicted 439
6 SASI_Hs01_00163549 predicted 941
7 SASI_Hs01_00163552 predicted 955
8 SASI_Hs01_00163553 predicted 789
9 SASI_Hs02_00366808 predicted 1143
10 SASI_Hs02_00366809 predicted 958
11 SASI_Hs01_00163544 predicted 805
12 SASI_Hs01_00163545 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230215 predicted 393
2 SASI_Rn02_00230216 predicted 404
3 SASI_Rn02_00230217 predicted 411
4 SASI_Rn02_00230218 predicted 362
5 SASI_Rn02_00230219 predicted 353
6 SASI_Rn02_00230220 predicted 988
7 SASI_Rn02_00230221 predicted 981
8 SASI_Rn02_00230222 predicted 254
9 SASI_Rn02_00230223 predicted 346
10 SASI_Rn02_00230224 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189259 predicted 849
2 SASI_Mm01_00189260 predicted 632
3 SASI_Mm01_00189261 predicted 483
4 SASI_Mm01_00189262 predicted 1087
5 SASI_Mm01_00189263 predicted 496
6 SASI_Mm01_00189264 predicted 823
7 SASI_Mm01_00189265 predicted 646
8 SASI_Mm01_00189266 predicted 477
9 SASI_Mm01_00189267 predicted 1070
10 SASI_Mm01_00189268 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021950
MS4A1 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021950.3-1104s21c1
Sequence:CCGGGAGACATGCTGACTTTCATTTCTCGAGAAATGAAAGTCAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-311s1c1
Sequence:CCGGCCAGATTATGAATGGGCTCTTCTCGAGAAGAGCCCATTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-771s1c1
Sequence:CCGGGCTGGCATCGTTGAGAATGAACTCGAGTTCATTCTCAACGATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-963s1c1
Sequence:CCGGGAAGAAACAGAGACGAACTTTCTCGAGAAAGTTCGTCTCTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-698s1c1
Sequence:CCGGCAGCATACAATCTCTGTTCTTCTCGAGAAGAACAGAGATTGTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-526s1c1
Sequence:CCGGCCATTTCTGGAATGATTCTTTCTCGAGAAAGAATCATTCCAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021950
MS4A1 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021950.3-1104s21c1
Sequence:CCGGGAGACATGCTGACTTTCATTTCTCGAGAAATGAAAGTCAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-311s1c1
Sequence:CCGGCCAGATTATGAATGGGCTCTTCTCGAGAAGAGCCCATTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-771s1c1
Sequence:CCGGGCTGGCATCGTTGAGAATGAACTCGAGTTCATTCTCAACGATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-963s1c1
Sequence:CCGGGAAGAAACAGAGACGAACTTTCTCGAGAAAGTTCGTCTCTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-698s1c1
Sequence:CCGGCAGCATACAATCTCTGTTCTTCTCGAGAAGAACAGAGATTGTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-526s1c1
Sequence:CCGGCCATTTCTGGAATGATTCTTTCTCGAGAAAGAATCATTCCAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021950
MS4A1 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021950.3-1104s21c1
Sequence:CCGGGAGACATGCTGACTTTCATTTCTCGAGAAATGAAAGTCAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-311s1c1
Sequence:CCGGCCAGATTATGAATGGGCTCTTCTCGAGAAGAGCCCATTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-771s1c1
Sequence:CCGGGCTGGCATCGTTGAGAATGAACTCGAGTTCATTCTCAACGATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-963s1c1
Sequence:CCGGGAAGAAACAGAGACGAACTTTCTCGAGAAAGTTCGTCTCTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-698s1c1
Sequence:CCGGCAGCATACAATCTCTGTTCTTCTCGAGAAGAACAGAGATTGTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021950.2-526s1c1
Sequence:CCGGCCATTTCTGGAATGATTCTTTCTCGAGAAAGAATCATTCCAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007641
MS4A1 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007641.2-1068s1c1
Sequence:CCGGCCACAATCTATTCTCCATATTCTCGAGAATATGGAGAATAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-475s1c1
Sequence:CCGGGCTGCCATTTCTGGAATAATTCTCGAGAATTATTCCAGAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-756s1c1
Sequence:CCGGGTGTACCAGATCCAAATCTAACTCGAGTTAGATTTGGATCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-849s1c1
Sequence:CCGGTGGAGTATCTTCCCAACCAAACTCGAGTTTGGTTGGGAAGATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-593s1c1
Sequence:CCGGACGACTGTGAACCATCTAATTCTCGAGAATTAGATGGTTCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007641
MS4A1 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007641.2-1068s1c1
Sequence:CCGGCCACAATCTATTCTCCATATTCTCGAGAATATGGAGAATAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-475s1c1
Sequence:CCGGGCTGCCATTTCTGGAATAATTCTCGAGAATTATTCCAGAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-756s1c1
Sequence:CCGGGTGTACCAGATCCAAATCTAACTCGAGTTAGATTTGGATCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-849s1c1
Sequence:CCGGTGGAGTATCTTCCCAACCAAACTCGAGTTTGGTTGGGAAGATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-593s1c1
Sequence:CCGGACGACTGTGAACCATCTAATTCTCGAGAATTAGATGGTTCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007641
MS4A1 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007641.2-1068s1c1
Sequence:CCGGCCACAATCTATTCTCCATATTCTCGAGAATATGGAGAATAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-475s1c1
Sequence:CCGGGCTGCCATTTCTGGAATAATTCTCGAGAATTATTCCAGAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-756s1c1
Sequence:CCGGGTGTACCAGATCCAAATCTAACTCGAGTTAGATTTGGATCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-849s1c1
Sequence:CCGGTGGAGTATCTTCCCAACCAAACTCGAGTTTGGTTGGGAAGATACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007641.2-593s1c1
Sequence:CCGGACGACTGTGAACCATCTAATTCTCGAGAATTAGATGGTTCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks