EMAIL THIS PAGE TO A FRIEND

MS4A7

membrane-spanning 4-domains, subfamily A, member 7

Synonyms: 4SPAN2 CD20L4 CFFM4 MS4A8
UniProtKB ID: Q9GZW8, A6NP53, Q6IAG8
Gene ID:
Human(58475) Summary: This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(109225) membrane-spanning 4-domains, subfamily A, member 7
Rat(293744) membrane-spanning 4-domains, subfamily A, member 7
cow(767975) membrane-spanning 4-domains, subfamily A, member 7
domestic cat(101100917) membrane-spanning 4-domains, subfamily A, member 7
dog(612564) membrane-spanning 4-domains, subfamily A, member 7
sheep(101112761) membrane-spanning 4-domains, subfamily A, member 7
domestic guinea pig(100719485) membrane-spanning 4-domains, subfamily A, member 7
204 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140881 MISSION® esiRNA esiRNA human MS4A7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021201 Rosetta Predictions human pricing
NM_206938 Rosetta Predictions human pricing
NM_206939 Rosetta Predictions human pricing
NM_206940 Rosetta Predictions human pricing
NM_001106338 Rosetta Predictions rat pricing
NM_001025610 Rosetta Predictions mouse pricing
NM_027836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059924 predicted 774
2 SASI_Hs01_00059925 predicted 716
3 SASI_Hs01_00059926 predicted 674
4 SASI_Hs01_00059927 predicted 1287
5 SASI_Hs02_00354788 predicted 738
6 SASI_Hs01_00059928 predicted 722
7 SASI_Hs01_00059929 predicted 674
8 SASI_Hs01_00059930 predicted 1235
9 SASI_Hs01_00059931 predicted 678
10 SASI_Hs01_00059932 predicted 771
11 SASI_Hs01_00059933 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026662 predicted 641
2 SASI_Hs01_00026663 predicted 574
3 SASI_Hs01_00026664 predicted 540
4 SASI_Hs01_00026665 predicted 1155
5 SASI_Hs02_00373637 predicted 598
6 SASI_Hs01_00026666 predicted 586
7 SASI_Hs01_00026667 predicted 536
8 SASI_Hs01_00026668 predicted 1095
9 SASI_Hs01_00026669 predicted 541
10 SASI_Hs01_00026670 predicted 642
11 SASI_Hs01_00026671 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109858 predicted 725
2 SASI_Hs01_00109859 predicted 666
3 SASI_Hs01_00109860 predicted 628
4 SASI_Hs01_00109861 predicted 1237
5 SASI_Hs02_00373638 predicted 692
6 SASI_Hs01_00109862 predicted 670
7 SASI_Hs01_00109863 predicted 622
8 SASI_Hs01_00109864 predicted 1185
9 SASI_Hs01_00109865 predicted 626
10 SASI_Hs01_00109866 predicted 725
11 SASI_Hs01_00109867 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147392 predicted 590
2 SASI_Hs01_00147393 predicted 529
3 SASI_Hs01_00147394 predicted 487
4 SASI_Hs01_00147395 predicted 1103
5 SASI_Hs02_00373639 predicted 549
6 SASI_Hs01_00147396 predicted 537
7 SASI_Hs01_00147397 predicted 491
8 SASI_Hs01_00147398 predicted 1043
9 SASI_Hs01_00147399 predicted 493
10 SASI_Hs01_00147400 predicted 586
11 SASI_Hs01_00147401 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217988 predicted 451
2 SASI_Rn02_00217989 predicted 420
3 SASI_Rn02_00217990 predicted 790
4 SASI_Rn02_00217991 predicted 844
5 SASI_Rn02_00217992 predicted 716
6 SASI_Rn02_00217993 predicted 800
7 SASI_Rn02_00217994 predicted 514
8 SASI_Rn02_00217995 predicted 1009
9 SASI_Rn02_00217996 predicted 587
10 SASI_Rn02_00217997 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167068 predicted 268
2 SASI_Mm01_00167069 predicted 352
3 SASI_Mm01_00167070 predicted 526
4 SASI_Mm01_00167071 predicted 485
5 SASI_Mm01_00167072 predicted 544
6 SASI_Mm01_00167073 predicted 356
7 SASI_Mm01_00167074 predicted 579
8 SASI_Mm01_00167075 predicted 405
9 SASI_Mm01_00167076 predicted 517
10 SASI_Mm01_00167077 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184262 predicted 252
2 SASI_Mm01_00184263 predicted 337
3 SASI_Mm02_00332787 predicted 524
4 SASI_Mm01_00184265 predicted 587
5 SASI_Mm01_00184266 predicted 336
6 SASI_Mm01_00184267 predicted 612
7 SASI_Mm01_00184268 predicted 450
8 SASI_Mm01_00184269 predicted 268
9 SASI_Mm01_00184270 predicted 563
10 SASI_Mm01_00184271 predicted 462
11 SASI_Mm01_00184264 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021201
MS4A7 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1093s21c1
Sequence:CCGGCTCAAAGCCCAAGTCAATAAACTCGAGTTTATTGACTTGGGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1050s21c1
Sequence:CCGGGTTTACTATGAGTCGTTATTTCTCGAGAAATAACGACTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021201.4-896s21c1
Sequence:CCGGTCTTCACGGTCTTGGATATAACTCGAGTTATATCCAAGACCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-955s21c1
Sequence:CCGGACTCATGGTCAAGTGTGATTACTCGAGTAATCACACTTGACCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-411s1c1
Sequence:CCGGCCCACTTCAATCCAGCAATTTCTCGAGAAATTGCTGGATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-855s1c1
Sequence:CCGGCGACCCAGTCACAAGATCATACTCGAGTATGATCTTGTGACTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-243s1c1
Sequence:CCGGAGGGCATCACTATCCCTCAAACTCGAGTTTGAGGGATAGTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021201
MS4A7 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1093s21c1
Sequence:CCGGCTCAAAGCCCAAGTCAATAAACTCGAGTTTATTGACTTGGGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1050s21c1
Sequence:CCGGGTTTACTATGAGTCGTTATTTCTCGAGAAATAACGACTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021201.4-896s21c1
Sequence:CCGGTCTTCACGGTCTTGGATATAACTCGAGTTATATCCAAGACCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-955s21c1
Sequence:CCGGACTCATGGTCAAGTGTGATTACTCGAGTAATCACACTTGACCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-411s1c1
Sequence:CCGGCCCACTTCAATCCAGCAATTTCTCGAGAAATTGCTGGATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-855s1c1
Sequence:CCGGCGACCCAGTCACAAGATCATACTCGAGTATGATCTTGTGACTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-243s1c1
Sequence:CCGGAGGGCATCACTATCCCTCAAACTCGAGTTTGAGGGATAGTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021201
MS4A7 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1093s21c1
Sequence:CCGGCTCAAAGCCCAAGTCAATAAACTCGAGTTTATTGACTTGGGCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-1050s21c1
Sequence:CCGGGTTTACTATGAGTCGTTATTTCTCGAGAAATAACGACTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021201.4-896s21c1
Sequence:CCGGTCTTCACGGTCTTGGATATAACTCGAGTTATATCCAAGACCGTGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021201.4-955s21c1
Sequence:CCGGACTCATGGTCAAGTGTGATTACTCGAGTAATCACACTTGACCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-411s1c1
Sequence:CCGGCCCACTTCAATCCAGCAATTTCTCGAGAAATTGCTGGATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-855s1c1
Sequence:CCGGCGACCCAGTCACAAGATCATACTCGAGTATGATCTTGTGACTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021201.4-243s1c1
Sequence:CCGGAGGGCATCACTATCCCTCAAACTCGAGTTTGAGGGATAGTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027836
MS4A7 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-270s1c1
Sequence:CCGGGCCCTGATACTTGCAAGCTTTCTCGAGAAAGCTTGCAAGTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-757s1c1
Sequence:CCGGTGCCTCAATCACAAGATCATACTCGAGTATGATCTTGTGATTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-690s1c1
Sequence:CCGGGCTGGATACAGTTCTATCTTTCTCGAGAAAGATAGAACTGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-560s1c1
Sequence:CCGGCCTGTCCTTATTGTCTTACTTCTCGAGAAGTAAGACAATAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027836
MS4A7 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-270s1c1
Sequence:CCGGGCCCTGATACTTGCAAGCTTTCTCGAGAAAGCTTGCAAGTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-757s1c1
Sequence:CCGGTGCCTCAATCACAAGATCATACTCGAGTATGATCTTGTGATTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-690s1c1
Sequence:CCGGGCTGGATACAGTTCTATCTTTCTCGAGAAAGATAGAACTGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-560s1c1
Sequence:CCGGCCTGTCCTTATTGTCTTACTTCTCGAGAAGTAAGACAATAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027836
MS4A7 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-270s1c1
Sequence:CCGGGCCCTGATACTTGCAAGCTTTCTCGAGAAAGCTTGCAAGTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-757s1c1
Sequence:CCGGTGCCTCAATCACAAGATCATACTCGAGTATGATCTTGTGATTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-690s1c1
Sequence:CCGGGCTGGATACAGTTCTATCTTTCTCGAGAAAGATAGAACTGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027836.4-560s1c1
Sequence:CCGGCCTGTCCTTATTGTCTTACTTCTCGAGAAGTAAGACAATAAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks