EMAIL THIS PAGE TO A FRIEND

MSH3

mutS homolog 3

Synonyms: DUP MRP1
UniProtKB ID: P20585, A1L482, A6NMM6, Q6PJT5, Q86UQ6, Q92867
Gene ID:
Human(4437) Summary: The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
Mouse(17686) mutS homolog 3 (E. coli)
Rat(499505) mutS homolog 3 (E. coli)
sheep(101121679) mutS homolog 3 (E. coli)
domestic guinea pig(100730041) mutS homolog 3 (E. coli)
naked mole-rat(101700364) mutS homolog 3 (E. coli)
Domestic Rabbit(100337807) mutS homolog 3 (E. coli)
Zebrafish(565400) mutS homolog 3 (E. coli)
chicken(427318) mutS homolog 3 (E. coli)
dog(479164) mutS homolog 3 (E. coli)
cow(616744) mutS homolog 3 (E. coli)
Horse(100073255) mutS homolog 3 (E. coli)
domestic cat(101090919) mutS homolog 3 (E. coli)
Thale Cress(828659) DNA mismatch repair protein MSH3
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002439 Rosetta Predictions human pricing
XM_001065837 Rosetta Predictions rat pricing
XM_574830 Rosetta Predictions rat pricing
NM_010829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224785 predicted 1877
2 SASI_Hs01_00224786 predicted 928
3 SASI_Hs02_00333840 predicted 1098
4 SASI_Hs02_00333841 predicted 721
5 SASI_Hs01_00224787 predicted 3217
6 SASI_Hs01_00224788 predicted 998
7 SASI_Hs02_00333842 predicted 1059
8 SASI_Hs01_00224790 predicted 3427
9 SASI_Hs01_00224791 predicted 3387
10 SASI_Hs01_00224793 predicted 3197
11 SASI_Hs01_00224789 predicted 1603
12 SASI_Hs01_00224792 predicted 1780
13 SASI_Hs01_00224794 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315504 predicted 1935
2 SASI_Rn02_00315505 predicted 998
3 SASI_Rn02_00315506 predicted 470
4 SASI_Rn02_00315507 predicted 600
5 SASI_Rn02_00315508 predicted 893
6 SASI_Rn02_00315509 predicted 939
7 SASI_Rn02_00315510 predicted 982
8 SASI_Rn02_00315511 predicted 3164
9 SASI_Rn02_00315512 predicted 550
10 SASI_Rn02_00315513 predicted 3207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402667 predicted 604
2 SASI_Rn02_00402668 predicted 640
3 SASI_Rn02_00402669 predicted 463
4 SASI_Rn02_00402670 predicted 533
5 SASI_Rn02_00402671 predicted 558
6 SASI_Rn02_00402672 predicted 469
7 SASI_Rn02_00402673 predicted 779
8 SASI_Rn02_00402674 predicted 329
9 SASI_Rn02_00402675 predicted 483
10 SASI_Rn02_00402676 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319451 predicted 956
2 SASI_Mm01_00054074 predicted 854
3 SASI_Mm01_00054075 predicted 796
4 SASI_Mm01_00054076 predicted 267
5 SASI_Mm01_00054077 predicted 3188
6 SASI_Mm01_00054078 predicted 608
7 SASI_Mm01_00054080 predicted 654
8 SASI_Mm01_00054081 predicted 911
9 SASI_Mm01_00054082 predicted 1944
10 SASI_Mm01_00054083 predicted 1578
11 SASI_Mm01_00054079 predicted 2221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002439
MSH3 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2097s21c1
Sequence:CCGGTACGTAAATTGCCCGACATAGCTCGAGCTATGTCGGGCAATTTACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-3224s21c1
Sequence:CCGCTATGCTACACTTGAGTATTTCCTCGAGGAAATACTCAAGTGTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-1051s21c1
Sequence:CCGGAGCCCGAGAGCTCAATATTTACTCGAGTAAATATTGAGCTCTCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2543s21c1
Sequence:CCGGATACCAACTGATTGGGTAAAGCTCGAGCTTTACCCAATCAGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002439.1-4220s1c1
Sequence:CCGGGCACAGAAGGAATAAGGTCATCTCGAGATGACCTTATTCCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-2834s1c1
Sequence:CCGGCGGAGTACATTTATGGAAGAACTCGAGTTCTTCCATAAATGTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-1736s1c1
Sequence:CCGGCCACTCCTTAAATTAAGGGAACTCGAGTTCCCTTAATTTAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-3182s1c1
Sequence:CCGGGCAAGGAGTTATGGATTAAATCTCGAGATTTAATCCATAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-810s1c1
Sequence:CCGGGCCATTTAGATCACAACTTTACTCGAGTAAAGTTGTGATCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002439
MSH3 MISSION shRNA shRNA Plasmid DNA
mutS homolog 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2097s21c1
Sequence:CCGGTACGTAAATTGCCCGACATAGCTCGAGCTATGTCGGGCAATTTACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-3224s21c1
Sequence:CCGCTATGCTACACTTGAGTATTTCCTCGAGGAAATACTCAAGTGTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-1051s21c1
Sequence:CCGGAGCCCGAGAGCTCAATATTTACTCGAGTAAATATTGAGCTCTCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2543s21c1
Sequence:CCGGATACCAACTGATTGGGTAAAGCTCGAGCTTTACCCAATCAGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002439.1-4220s1c1
Sequence:CCGGGCACAGAAGGAATAAGGTCATCTCGAGATGACCTTATTCCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-2834s1c1
Sequence:CCGGCGGAGTACATTTATGGAAGAACTCGAGTTCTTCCATAAATGTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-1736s1c1
Sequence:CCGGCCACTCCTTAAATTAAGGGAACTCGAGTTCCCTTAATTTAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-3182s1c1
Sequence:CCGGGCAAGGAGTTATGGATTAAATCTCGAGATTTAATCCATAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-810s1c1
Sequence:CCGGGCCATTTAGATCACAACTTTACTCGAGTAAAGTTGTGATCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002439
MSH3 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2097s21c1
Sequence:CCGGTACGTAAATTGCCCGACATAGCTCGAGCTATGTCGGGCAATTTACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-3224s21c1
Sequence:CCGCTATGCTACACTTGAGTATTTCCTCGAGGAAATACTCAAGTGTAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-1051s21c1
Sequence:CCGGAGCCCGAGAGCTCAATATTTACTCGAGTAAATATTGAGCTCTCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002439.3-2543s21c1
Sequence:CCGGATACCAACTGATTGGGTAAAGCTCGAGCTTTACCCAATCAGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002439.1-4220s1c1
Sequence:CCGGGCACAGAAGGAATAAGGTCATCTCGAGATGACCTTATTCCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-2834s1c1
Sequence:CCGGCGGAGTACATTTATGGAAGAACTCGAGTTCTTCCATAAATGTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-1736s1c1
Sequence:CCGGCCACTCCTTAAATTAAGGGAACTCGAGTTCCCTTAATTTAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-3182s1c1
Sequence:CCGGGCAAGGAGTTATGGATTAAATCTCGAGATTTAATCCATAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002439.1-810s1c1
Sequence:CCGGGCCATTTAGATCACAACTTTACTCGAGTAAAGTTGTGATCTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010829
VALIDATED
MSH3 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3421s1c1
Sequence:CCGGCAGAGAACTGAAGATTCAAACCTCGAGGTTTGAATCTTCAGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.2-2214s1c1
Sequence:CCGGCTGTATCAGGACAAGAGTTTACTCGAGTAAACTCTTGTCCTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3639s1c1
Sequence:CCGGGGTTCTTGGTGCCTACATTATCTCGAGATAATGTAGGCACCAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-268s1c1
Sequence:CCGGCTTCGGGAGAGACTTGAAGTTCTCGAGAACTTCAAGTCTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-770s1c1
Sequence:CCGGCCGCTCTTTATACGAAATCCACTCGAGTGGATTTCGTATAAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-880s1c1
Sequence:CCGGCTTCTGTGTATCTACGAAGAACTCGAGTTCTTCGTAGATACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-469s1c1
Sequence:CCGGCCGTTAGAACTGCAGTACTTACTCGAGTAAGTACTGCAGTTCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-414s1c1
Sequence:CCGGCCAGAAGACTTCCGATTGTAACTCGAGTTACAATCGGAAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-692s1c1
Sequence:CCGGGAGTTGTGAAGCAAACTGAAACTCGAGTTTCAGTTTGCTTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010829
VALIDATED
MSH3 MISSION shRNA shRNA Plasmid DNA
mutS homolog 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3421s1c1
Sequence:CCGGCAGAGAACTGAAGATTCAAACCTCGAGGTTTGAATCTTCAGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.2-2214s1c1
Sequence:CCGGCTGTATCAGGACAAGAGTTTACTCGAGTAAACTCTTGTCCTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3639s1c1
Sequence:CCGGGGTTCTTGGTGCCTACATTATCTCGAGATAATGTAGGCACCAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-268s1c1
Sequence:CCGGCTTCGGGAGAGACTTGAAGTTCTCGAGAACTTCAAGTCTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-770s1c1
Sequence:CCGGCCGCTCTTTATACGAAATCCACTCGAGTGGATTTCGTATAAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-880s1c1
Sequence:CCGGCTTCTGTGTATCTACGAAGAACTCGAGTTCTTCGTAGATACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-469s1c1
Sequence:CCGGCCGTTAGAACTGCAGTACTTACTCGAGTAAGTACTGCAGTTCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-414s1c1
Sequence:CCGGCCAGAAGACTTCCGATTGTAACTCGAGTTACAATCGGAAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-692s1c1
Sequence:CCGGGAGTTGTGAAGCAAACTGAAACTCGAGTTTCAGTTTGCTTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010829
VALIDATED
MSH3 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3421s1c1
Sequence:CCGGCAGAGAACTGAAGATTCAAACCTCGAGGTTTGAATCTTCAGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.2-2214s1c1
Sequence:CCGGCTGTATCAGGACAAGAGTTTACTCGAGTAAACTCTTGTCCTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010829.2-3639s1c1
Sequence:CCGGGGTTCTTGGTGCCTACATTATCTCGAGATAATGTAGGCACCAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-268s1c1
Sequence:CCGGCTTCGGGAGAGACTTGAAGTTCTCGAGAACTTCAAGTCTCTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-770s1c1
Sequence:CCGGCCGCTCTTTATACGAAATCCACTCGAGTGGATTTCGTATAAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010829.1-880s1c1
Sequence:CCGGCTTCTGTGTATCTACGAAGAACTCGAGTTCTTCGTAGATACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-469s1c1
Sequence:CCGGCCGTTAGAACTGCAGTACTTACTCGAGTAAGTACTGCAGTTCTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-414s1c1
Sequence:CCGGCCAGAAGACTTCCGATTGTAACTCGAGTTACAATCGGAAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010829.1-692s1c1
Sequence:CCGGGAGTTGTGAAGCAAACTGAAACTCGAGTTTCAGTTTGCTTCACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks