EMAIL THIS PAGE TO A FRIEND

MSL1

male-specific lethal 1 homolog (Drosophila)

Synonyms: MSL-1 hMSL1
UniProtKB ID: Q68DK7, Q0VF46, Q69Z03
Gene ID:
Mouse(74026) male-specific lethal 1 homolog (Drosophila)
Rat(303514) male-specific lethal 1 homolog (Drosophila)
chicken(777194) male-specific lethal 1 homolog (Drosophila)
domestic cat(101095624) male-specific lethal 1 homolog (Drosophila)
cow(787839) male-specific lethal 1 homolog (Drosophila)
Horse(100067838) male-specific lethal 1 homolog (Drosophila)
dog(100688164) male-specific lethal 1 homolog (Drosophila)
sheep(101106604) male-specific lethal 1 homolog (Drosophila)
domestic guinea pig(100729340) male-specific lethal 1 homolog (Drosophila)
naked mole-rat(101726334) male-specific lethal 1 homolog (Drosophila)
269 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051971 MISSION® esiRNA esiRNA targeting mouse Msl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012241 Rosetta Predictions human pricing
XM_496217 Rosetta Predictions human pricing
XM_932069 Rosetta Predictions human pricing
XM_932082 Rosetta Predictions human pricing
XM_932089 Rosetta Predictions human pricing
XM_932097 Rosetta Predictions human pricing
XM_932101 Rosetta Predictions human pricing
XM_932107 Rosetta Predictions human pricing
NM_001107048 Rosetta Predictions rat pricing
NM_028722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306047 predicted 393
2 SASI_Hs02_00306048 predicted 1455
3 SASI_Hs02_00306049 predicted 359
4 SASI_Hs02_00306050 predicted 826
5 SASI_Hs02_00306051 predicted 1383
6 SASI_Hs02_00306052 predicted 1483
7 SASI_Hs02_00306053 predicted 834
8 SASI_Hs02_00306054 predicted 1010
9 SASI_Hs02_00306055 predicted 816
10 SASI_Hs02_00306056 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298830 predicted 1741
2 SASI_Hs01_00298831 predicted 1551
3 SASI_Hs01_00298832 predicted 1124
4 SASI_Hs01_00298833 predicted 2194
5 SASI_Hs01_00298834 predicted 1091
6 SASI_Hs01_00298835 predicted 959
7 SASI_Hs01_00298836 predicted 1559
8 SASI_Hs01_00298837 predicted 2114
9 SASI_Hs01_00298838 predicted 872
10 SASI_Hs01_00298839 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282534 predicted 1609
2 SASI_Hs01_00282535 predicted 1725
3 SASI_Hs01_00282536 predicted 1565
4 SASI_Hs01_00282537 predicted 1360
5 SASI_Hs01_00282538 predicted 1495
6 SASI_Hs01_00282539 predicted 1982
7 SASI_Hs01_00282540 predicted 1594
8 SASI_Hs01_00282541 predicted 1746
9 SASI_Hs01_00282542 predicted 1987
10 SASI_Hs01_00282543 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291512 predicted 1119
2 SASI_Hs01_00291513 predicted 1205
3 SASI_Hs01_00291514 predicted 1519
4 SASI_Hs01_00291515 predicted 1078
5 SASI_Hs01_00291516 predicted 968
6 SASI_Hs01_00291517 predicted 1120
7 SASI_Hs01_00291518 predicted 1400
8 SASI_Hs01_00291519 predicted 1137
9 SASI_Hs01_00291520 predicted 948
10 SASI_Hs01_00291521 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282626 predicted 1758
2 SASI_Hs01_00282627 predicted 1650
3 SASI_Hs01_00282628 predicted 1557
4 SASI_Hs01_00282629 predicted 1128
5 SASI_Hs01_00282630 predicted 961
6 SASI_Hs01_00282631 predicted 1529
7 SASI_Hs01_00282632 predicted 1567
8 SASI_Hs01_00282633 predicted 1408
9 SASI_Hs01_00282634 predicted 1369
10 SASI_Hs01_00282635 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271374 predicted 1750
2 SASI_Hs01_00271375 predicted 1556
3 SASI_Hs01_00271376 predicted 1127
4 SASI_Hs01_00271377 predicted 2191
5 SASI_Hs01_00271378 predicted 1098
6 SASI_Hs01_00271379 predicted 959
7 SASI_Hs01_00271380 predicted 1558
8 SASI_Hs01_00271381 predicted 2116
9 SASI_Hs01_00271382 predicted 870
10 SASI_Hs01_00271383 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286533 predicted 962
2 SASI_Hs01_00286534 predicted 773
3 SASI_Hs01_00286535 predicted 342
4 SASI_Hs01_00286536 predicted 1410
5 SASI_Hs01_00286537 predicted 319
6 SASI_Hs01_00286538 predicted 770
7 SASI_Hs01_00286539 predicted 1333
8 SASI_Hs01_00286540 predicted 346
9 SASI_Hs01_00286541 predicted 1442
10 SASI_Hs01_00286542 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254418 predicted 1693
2 SASI_Hs01_00254419 predicted 1554
3 SASI_Hs01_00254420 predicted 1120
4 SASI_Hs01_00254421 predicted 2146
5 SASI_Hs01_00254422 predicted 1100
6 SASI_Hs01_00254423 predicted 961
7 SASI_Hs01_00254424 predicted 1554
8 SASI_Hs01_00254425 predicted 2073
9 SASI_Hs01_00254426 predicted 871
10 SASI_Hs01_00254427 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224976 predicted 1660
2 SASI_Rn02_00224977 predicted 1104
3 SASI_Rn02_00224978 predicted 1303
4 SASI_Rn02_00224979 predicted 1661
5 SASI_Rn02_00224980 predicted 713
6 SASI_Rn02_00224981 predicted 1312
7 SASI_Rn02_00224982 predicted 984
8 SASI_Rn02_00224983 predicted 1825
9 SASI_Rn02_00224984 predicted 1875
10 SASI_Rn02_00224985 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121046 predicted 2004
2 SASI_Mm01_00121048 predicted 1140
3 SASI_Mm01_00121049 predicted 1338
4 SASI_Mm01_00121050 predicted 1140
5 SASI_Mm01_00121051 predicted 660
6 SASI_Mm01_00121052 predicted 1937
7 SASI_Mm01_00121053 predicted 748
8 SASI_Mm01_00121054 predicted 1698
9 SASI_Mm01_00121055 predicted 1340
10 SASI_Mm02_00334285 predicted 1169
11 SASI_Mm01_00121047 predicted 1782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012241
VALIDATED
MSL1 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1560s21c1
Sequence:CCGGACTCTTTCATTCGGCTAATTGCTCGAGCAATTAGCCGAATGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1194s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1269s21c1
Sequence:CCGGGTAGCATTTGGACGACCATTACTCGAGTAATGGTCGTCCAAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-521s21c1
Sequence:CCGGGCGGAGTGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1377s21c1
Sequence:CCGGCACCGGACGTGTAGGAAATAGCTCGAGCTATTTCCTACACGTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1489s21c1
Sequence:GTACCGGATGTTATCACTCGCTGATAATCTCGAGATTATCAGCGAGTGATAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-675s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012241
VALIDATED
MSL1 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1560s21c1
Sequence:CCGGACTCTTTCATTCGGCTAATTGCTCGAGCAATTAGCCGAATGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1194s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1269s21c1
Sequence:CCGGGTAGCATTTGGACGACCATTACTCGAGTAATGGTCGTCCAAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-521s21c1
Sequence:CCGGGCGGAGTGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1377s21c1
Sequence:CCGGCACCGGACGTGTAGGAAATAGCTCGAGCTATTTCCTACACGTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1489s21c1
Sequence:GTACCGGATGTTATCACTCGCTGATAATCTCGAGATTATCAGCGAGTGATAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-675s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012241
VALIDATED
MSL1 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 1 homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1560s21c1
Sequence:CCGGACTCTTTCATTCGGCTAATTGCTCGAGCAATTAGCCGAATGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1194s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1269s21c1
Sequence:CCGGGTAGCATTTGGACGACCATTACTCGAGTAATGGTCGTCCAAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-521s21c1
Sequence:CCGGGCGGAGTGGAAAGGGACATAACTCGAGTTATGTCCCTTTCCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1377s21c1
Sequence:CCGGCACCGGACGTGTAGGAAATAGCTCGAGCTATTTCCTACACGTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-1489s21c1
Sequence:GTACCGGATGTTATCACTCGCTGATAATCTCGAGATTATCAGCGAGTGATAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012241.1-675s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028722
VALIDATED
MSL1 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1143s21c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1710s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.2-1143s1c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1191s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1340s21c1
Sequence:CCGGGTACCTTTCCACCACAGAAATCTCGAGATTTCTGTGGTGGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-3933s21c1
Sequence:CCGGTTTCCCTGAGGACCTACTATTCTCGAGAATAGTAGGTCCTCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2495s1c1
Sequence:CCGGGCTCTTCATTAGCGTGTCTAACTCGAGTTAGACACGCTAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.1-1783s1c1
Sequence:CCGGGACCCAAATCCTTCAGACATTCTCGAGAATGTCTGAAGGATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2687s1c1
Sequence:CCGGCCTGAAAGTTTGTTCTCTTTACTCGAGTAAAGAGAACAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028722
VALIDATED
MSL1 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1143s21c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1710s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.2-1143s1c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1191s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1340s21c1
Sequence:CCGGGTACCTTTCCACCACAGAAATCTCGAGATTTCTGTGGTGGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-3933s21c1
Sequence:CCGGTTTCCCTGAGGACCTACTATTCTCGAGAATAGTAGGTCCTCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2495s1c1
Sequence:CCGGGCTCTTCATTAGCGTGTCTAACTCGAGTTAGACACGCTAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.1-1783s1c1
Sequence:CCGGGACCCAAATCCTTCAGACATTCTCGAGAATGTCTGAAGGATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2687s1c1
Sequence:CCGGCCTGAAAGTTTGTTCTCTTTACTCGAGTAAAGAGAACAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028722
VALIDATED
MSL1 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 1 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1143s21c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1710s21c1
Sequence:CCGGGAGCCTGAGGTTACCTCATTTCTCGAGAAATGAGGTAACCTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.2-1143s1c1
Sequence:CCGGCCTAAGCACTCTCCCATTAAACTCGAGTTTAATGGGAGAGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1191s21c1
Sequence:CCGGACTGTTTGTAAACGTGAATTGCTCGAGCAATTCACGTTTACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-1340s21c1
Sequence:CCGGGTACCTTTCCACCACAGAAATCTCGAGATTTCTGTGGTGGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028722.2-3933s21c1
Sequence:CCGGTTTCCCTGAGGACCTACTATTCTCGAGAATAGTAGGTCCTCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193034    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2495s1c1
Sequence:CCGGGCTCTTCATTAGCGTGTCTAACTCGAGTTAGACACGCTAATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028722.1-1783s1c1
Sequence:CCGGGACCCAAATCCTTCAGACATTCTCGAGAATGTCTGAAGGATTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028722.1-2687s1c1
Sequence:CCGGCCTGAAAGTTTGTTCTCTTTACTCGAGTAAAGAGAACAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks