EMAIL THIS PAGE TO A FRIEND

MSL3

male-specific lethal 3 homolog (Drosophila)

Synonyms: MSL3L1
Gene ID:
Human(10943) Summary: This gene encodes a nuclear protein that is similar to the product of the Drosophila male-specific lethal-3 gene. The Drosophila protein plays a critical role in a dosage-compensation pathway, which equalizes X-linked gene expression in males and females. Thus, the human protein is thought to play a similar function in chromatin remodeling and transcriptional regulation, and it has been found as part of a complex that is responsible for histone H4 lysine-16 acetylation. This gene can undergo X inactivation. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 7 and 8. [provided by RefSeq, Jul 2010]
Mouse(17692) male-specific lethal 3 homolog (Drosophila)
Rat(317464) male-specific lethal 3 homolog (Drosophila)
Thale Cress(842187) MSCS-like 3
domestic cat(101086287) male-specific lethal 3 homolog (Drosophila)
cow(515220) male-specific lethal 3 homolog (Drosophila)
Horse(100054131) male-specific lethal 3 homolog (Drosophila)
dog(491742) male-specific lethal 3 homolog (Drosophila)
chicken(418641) male-specific lethal 3 homolog (Drosophila)
sheep(101119018) male-specific lethal 3 homolog (Drosophila)
domestic guinea pig(100713886) male-specific lethal 3 homolog (Drosophila)
naked mole-rat(101698996) male-specific lethal 3 homolog (Drosophila)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006800 Rosetta Predictions human pricing
NM_078628 Rosetta Predictions human pricing
NM_078629 Rosetta Predictions human pricing
NM_078630 Rosetta Predictions human pricing
NM_001014111 Rosetta Predictions rat pricing
NM_010832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177519 predicted 962
2 SASI_Hs01_00177520 predicted 893
3 SASI_Hs01_00177521 predicted 633
4 SASI_Hs01_00177522 predicted 934
5 SASI_Hs01_00177523 predicted 759
6 SASI_Hs01_00177524 predicted 931
7 SASI_Hs01_00177525 predicted 1694
8 SASI_Hs01_00177526 predicted 1692
9 SASI_Hs01_00177527 predicted 1439
10 SASI_Hs01_00177528 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030139 predicted 808
2 SASI_Hs01_00030140 predicted 1023
3 SASI_Hs01_00030141 predicted 953
4 SASI_Hs01_00030142 predicted 1031
5 SASI_Hs01_00030143 predicted 991
6 SASI_Hs01_00030144 predicted 812
7 SASI_Hs01_00030145 predicted 813
8 SASI_Hs01_00030147 predicted 1003
9 SASI_Hs01_00030148 predicted 990
10 SASI_Hs02_00362181 predicted 988
11 SASI_Hs01_00030146 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239432 predicted 809
2 SASI_Hs01_00239433 predicted 1023
3 SASI_Hs01_00239434 predicted 949
4 SASI_Hs01_00239435 predicted 1033
5 SASI_Hs01_00239436 predicted 989
6 SASI_Hs01_00239437 predicted 815
7 SASI_Hs01_00239438 predicted 816
8 SASI_Hs01_00239440 predicted 1006
9 SASI_Hs01_00239441 predicted 987
10 SASI_Hs02_00362182 predicted 984
11 SASI_Hs01_00239439 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021864 predicted 937
2 SASI_Hs01_00021865 predicted 869
3 SASI_Hs01_00021866 predicted 604
4 SASI_Hs01_00021867 predicted 905
5 SASI_Hs01_00021868 predicted 733
6 SASI_Hs01_00021869 predicted 907
7 SASI_Hs01_00021870 predicted 1663
8 SASI_Hs01_00021871 predicted 1662
9 SASI_Hs01_00021872 predicted 1410
10 SASI_Hs01_00021873 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102856 predicted 1362
2 SASI_Rn01_00102858 predicted 700
3 SASI_Rn01_00102859 predicted 820
4 SASI_Rn01_00102860 predicted 1222
5 SASI_Rn01_00102861 predicted 420
6 SASI_Rn01_00102862 predicted 1145
7 SASI_Rn02_00201553 predicted 507
8 SASI_Rn01_00102863 predicted 431
9 SASI_Rn01_00102864 predicted 1328
10 SASI_Rn01_00102865 predicted 372
11 SASI_Rn01_00102857 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161811 predicted 1343
2 SASI_Mm01_00161812 predicted 821
3 SASI_Mm02_00319460 predicted 1217
4 SASI_Mm01_00161814 predicted 778
5 SASI_Mm01_00161815 predicted 1355
6 SASI_Mm01_00161816 predicted 760
7 SASI_Mm02_00319461 predicted 791
8 SASI_Mm01_00161817 predicted 822
9 SASI_Mm01_00161818 predicted 1354
10 SASI_Mm01_00161819 predicted 819
11 SASI_Mm01_00161810 predicted 1440
12 SASI_Mm01_00161813 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010832
VALIDATED
MSL3 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 3 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-429s21c1
Sequence:CCGGCACCGTCAGCGTCGTATTAAACTCGAGTTTAATACGACGCTGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-793s21c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-1837s21c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-482s21c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-227s21c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-1839s1c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-795s1c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010832.2-796s1c1
Sequence:CCGGCTTTGATTATACGCTCCCATTCTCGAGAATGGGAGCGTATAATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-484s1c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-229s1c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010832
VALIDATED
MSL3 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 3 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-429s21c1
Sequence:CCGGCACCGTCAGCGTCGTATTAAACTCGAGTTTAATACGACGCTGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-793s21c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-1837s21c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-482s21c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-227s21c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-1839s1c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-795s1c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010832.2-796s1c1
Sequence:CCGGCTTTGATTATACGCTCCCATTCTCGAGAATGGGAGCGTATAATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-484s1c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-229s1c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010832
VALIDATED
MSL3 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 3 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-429s21c1
Sequence:CCGGCACCGTCAGCGTCGTATTAAACTCGAGTTTAATACGACGCTGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-793s21c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-1837s21c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-482s21c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010832.4-227s21c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-1839s1c1
Sequence:CCGGGCCTGAACATATTCCAAAGTACTCGAGTACTTTGGAATATGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-795s1c1
Sequence:CCGGCCTTTGATTATACGCTCCCATCTCGAGATGGGAGCGTATAATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010832.2-796s1c1
Sequence:CCGGCTTTGATTATACGCTCCCATTCTCGAGAATGGGAGCGTATAATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-484s1c1
Sequence:CCGGGCTGCGTTCAAGAAAGGAAATCTCGAGATTTCCTTTCTTGAACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010832.2-229s1c1
Sequence:CCGGCCGGAGATTACAGCGCAAATTCTCGAGAATTTGCGCTGTAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006800
VALIDATED
MSL3 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 3 homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006800.2-1871s21c1
Sequence:CCGGCAGTGAAATATTCGTGGAATACTCGAGTATTCCACGAATATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1577s21c1
Sequence:CCGGGCACATTACAGCACCAAGAACCTCGAGGTTCTTGGTGCTGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1542s21c1
Sequence:CCGGTCTTCCCAGAGTCGGCTTATGCTCGAGCATAAGCCGACTCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1063s21c1
Sequence:CCGGCAAAGCTGAGCCAGAAGCATTCTCGAGAATGCTTCTGGCTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-978s21c1
Sequence:CCGGCCAGTCCGCCTTTGTTGAATCCTCGAGGATTCAACAAAGGCGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-773s1c1
Sequence:CCGGGTGCATTATATCCCAGCAGAACTCGAGTTCTGCTGGGATATAATGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006800.2-1573s1c1
Sequence:CCGGTGAGGCACATTACAGCACCAACTCGAGTTGGTGCTGTAATGTGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1248s1c1
Sequence:CCGGCACCTATTCCTCTGACTCCTACTCGAGTAGGAGTCAGAGGAATAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-981s1c1
Sequence:CCGGGTCCGCCTTTGTTGAATCCATCTCGAGATGGATTCAACAAAGGCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1418s1c1
Sequence:CCGGCTGCGATTGTTTGTGAAACTTCTCGAGAAGTTTCACAAACAATCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006800
VALIDATED
MSL3 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 3 homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006800.2-1871s21c1
Sequence:CCGGCAGTGAAATATTCGTGGAATACTCGAGTATTCCACGAATATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1577s21c1
Sequence:CCGGGCACATTACAGCACCAAGAACCTCGAGGTTCTTGGTGCTGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1542s21c1
Sequence:CCGGTCTTCCCAGAGTCGGCTTATGCTCGAGCATAAGCCGACTCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1063s21c1
Sequence:CCGGCAAAGCTGAGCCAGAAGCATTCTCGAGAATGCTTCTGGCTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-978s21c1
Sequence:CCGGCCAGTCCGCCTTTGTTGAATCCTCGAGGATTCAACAAAGGCGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-773s1c1
Sequence:CCGGGTGCATTATATCCCAGCAGAACTCGAGTTCTGCTGGGATATAATGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006800.2-1573s1c1
Sequence:CCGGTGAGGCACATTACAGCACCAACTCGAGTTGGTGCTGTAATGTGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1248s1c1
Sequence:CCGGCACCTATTCCTCTGACTCCTACTCGAGTAGGAGTCAGAGGAATAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-981s1c1
Sequence:CCGGGTCCGCCTTTGTTGAATCCATCTCGAGATGGATTCAACAAAGGCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1418s1c1
Sequence:CCGGCTGCGATTGTTTGTGAAACTTCTCGAGAAGTTTCACAAACAATCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006800
VALIDATED
MSL3 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 3 homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006800.2-1871s21c1
Sequence:CCGGCAGTGAAATATTCGTGGAATACTCGAGTATTCCACGAATATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1577s21c1
Sequence:CCGGGCACATTACAGCACCAAGAACCTCGAGGTTCTTGGTGCTGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1542s21c1
Sequence:CCGGTCTTCCCAGAGTCGGCTTATGCTCGAGCATAAGCCGACTCTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-1063s21c1
Sequence:CCGGCAAAGCTGAGCCAGAAGCATTCTCGAGAATGCTTCTGGCTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006800.2-978s21c1
Sequence:CCGGCCAGTCCGCCTTTGTTGAATCCTCGAGGATTCAACAAAGGCGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-773s1c1
Sequence:CCGGGTGCATTATATCCCAGCAGAACTCGAGTTCTGCTGGGATATAATGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006800.2-1573s1c1
Sequence:CCGGTGAGGCACATTACAGCACCAACTCGAGTTGGTGCTGTAATGTGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1248s1c1
Sequence:CCGGCACCTATTCCTCTGACTCCTACTCGAGTAGGAGTCAGAGGAATAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-981s1c1
Sequence:CCGGGTCCGCCTTTGTTGAATCCATCTCGAGATGGATTCAACAAAGGCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006800.2-1418s1c1
Sequence:CCGGCTGCGATTGTTTGTGAAACTTCTCGAGAAGTTTCACAAACAATCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks