EMAIL THIS PAGE TO A FRIEND

MT2A

metallothionein 2A

Synonyms: MT2
UniProtKB ID: P02795, Q14823, Q2HXR9, Q53XT9
Gene ID:
Rat(689415) metallothionein 2A
sheep(101117955) metallothionein 2A
Thale Cress(820098) metallothionein 2A
dog(403768) metallothionein 1H
cow(404070) metallothionein 2A
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005953 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112591 MISSION® esiRNA esiRNA human MT2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005953 Rosetta Predictions human pricing
XM_001070713 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136892 predicted 322
2 SASI_Hs01_00136893 predicted 278
3 SASI_Hs01_00136894 predicted 313
4 SASI_Hs01_00136895 predicted 317
5 SASI_Hs01_00136896 predicted 125
6 SASI_Hs01_00136897 predicted 256
7 SASI_Hs01_00136898 predicted 314
8 SASI_Hs01_00136899 predicted 273
9 SASI_Hs01_00136900 predicted 118
10 SASI_Hs01_00136901 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332519 predicted 246
2 SASI_Rn02_00332520 predicted 239
3 SASI_Rn02_00332521 predicted 246
4 SASI_Rn02_00332522 predicted 99
5 SASI_Rn02_00332523 predicted 97
6 SASI_Rn02_00332524 predicted 303
7 SASI_Rn02_00332525 predicted 94
8 SASI_Rn02_00332526 predicted 244
9 SASI_Rn02_00332527 predicted 247
10 SASI_Rn02_00332528 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005953
MT2A MISSION shRNA Bacterial Glycerol Stock
metallothionein 2A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-119s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACTTCTCGAGAAGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-129s1c1
Sequence:CCGGCAAATGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-113s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-111s1c1
Sequence:CCGGCTGCAAATGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005953
MT2A MISSION shRNA shRNA Plasmid DNA
metallothionein 2A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-119s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACTTCTCGAGAAGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-129s1c1
Sequence:CCGGCAAATGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-113s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-111s1c1
Sequence:CCGGCTGCAAATGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005953
MT2A MISSION shRNA Lentiviral Transduction Particles
metallothionein 2A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-119s1c1
Sequence:CCGGGCAAAGAGTGCAAATGCACTTCTCGAGAAGTGCATTTGCACTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-129s1c1
Sequence:CCGGCAAATGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-113s1c1
Sequence:CCGGGCAAATGCAAAGAGTGCAAATCTCGAGATTTGCACTCTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005953.2-111s1c1
Sequence:CCGGCTGCAAATGCAAAGAGTGCAACTCGAGTTGCACTCTTTGCATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks